ID: 1148196823

View in Genome Browser
Species Human (GRCh38)
Location 17:45720008-45720030
Sequence CTCCCAGGAAACCACAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148196815_1148196823 23 Left 1148196815 17:45719962-45719984 CCAGAGGTGCAGTCTCATGTTCC No data
Right 1148196823 17:45720008-45720030 CTCCCAGGAAACCACAGTGTGGG No data
1148196814_1148196823 26 Left 1148196814 17:45719959-45719981 CCACCAGAGGTGCAGTCTCATGT No data
Right 1148196823 17:45720008-45720030 CTCCCAGGAAACCACAGTGTGGG No data
1148196817_1148196823 2 Left 1148196817 17:45719983-45720005 CCTTCTGGTTACAAATGATCCCT No data
Right 1148196823 17:45720008-45720030 CTCCCAGGAAACCACAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148196823 Original CRISPR CTCCCAGGAAACCACAGTGT GGG Intergenic
No off target data available for this crispr