ID: 1148197993

View in Genome Browser
Species Human (GRCh38)
Location 17:45728632-45728654
Sequence TGCCCCGGTGAAGTTCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148197993_1148198001 16 Left 1148197993 17:45728632-45728654 CCACATGGAACTTCACCGGGGCA No data
Right 1148198001 17:45728671-45728693 GAGTGGGCTGACCAAGAGGAGGG No data
1148197993_1148197998 0 Left 1148197993 17:45728632-45728654 CCACATGGAACTTCACCGGGGCA No data
Right 1148197998 17:45728655-45728677 GGTAATTGAACTAGTGGAGTGGG No data
1148197993_1148198000 15 Left 1148197993 17:45728632-45728654 CCACATGGAACTTCACCGGGGCA No data
Right 1148198000 17:45728670-45728692 GGAGTGGGCTGACCAAGAGGAGG No data
1148197993_1148197997 -1 Left 1148197993 17:45728632-45728654 CCACATGGAACTTCACCGGGGCA No data
Right 1148197997 17:45728654-45728676 AGGTAATTGAACTAGTGGAGTGG No data
1148197993_1148198002 17 Left 1148197993 17:45728632-45728654 CCACATGGAACTTCACCGGGGCA No data
Right 1148198002 17:45728672-45728694 AGTGGGCTGACCAAGAGGAGGGG No data
1148197993_1148197996 -6 Left 1148197993 17:45728632-45728654 CCACATGGAACTTCACCGGGGCA No data
Right 1148197996 17:45728649-45728671 GGGGCAGGTAATTGAACTAGTGG No data
1148197993_1148197999 12 Left 1148197993 17:45728632-45728654 CCACATGGAACTTCACCGGGGCA No data
Right 1148197999 17:45728667-45728689 AGTGGAGTGGGCTGACCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148197993 Original CRISPR TGCCCCGGTGAAGTTCCATG TGG (reversed) Intergenic
No off target data available for this crispr