ID: 1148197996

View in Genome Browser
Species Human (GRCh38)
Location 17:45728649-45728671
Sequence GGGGCAGGTAATTGAACTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148197988_1148197996 14 Left 1148197988 17:45728612-45728634 CCAGCTGCTGAGGTTGACAGCCA No data
Right 1148197996 17:45728649-45728671 GGGGCAGGTAATTGAACTAGTGG No data
1148197993_1148197996 -6 Left 1148197993 17:45728632-45728654 CCACATGGAACTTCACCGGGGCA No data
Right 1148197996 17:45728649-45728671 GGGGCAGGTAATTGAACTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148197996 Original CRISPR GGGGCAGGTAATTGAACTAG TGG Intergenic
No off target data available for this crispr