ID: 1148198000

View in Genome Browser
Species Human (GRCh38)
Location 17:45728670-45728692
Sequence GGAGTGGGCTGACCAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148197995_1148198000 0 Left 1148197995 17:45728647-45728669 CCGGGGCAGGTAATTGAACTAGT No data
Right 1148198000 17:45728670-45728692 GGAGTGGGCTGACCAAGAGGAGG No data
1148197993_1148198000 15 Left 1148197993 17:45728632-45728654 CCACATGGAACTTCACCGGGGCA No data
Right 1148198000 17:45728670-45728692 GGAGTGGGCTGACCAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148198000 Original CRISPR GGAGTGGGCTGACCAAGAGG AGG Intergenic
No off target data available for this crispr