ID: 1148198850

View in Genome Browser
Species Human (GRCh38)
Location 17:45734538-45734560
Sequence GTTTAAGTCATTCCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 270}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148198850_1148198858 -1 Left 1148198850 17:45734538-45734560 CCAGCCTCAGGAATGACTTAAAC 0: 1
1: 0
2: 1
3: 20
4: 270
Right 1148198858 17:45734560-45734582 CCAGGGACTCTGGGGCCACCAGG 0: 1
1: 1
2: 2
3: 68
4: 475
1148198850_1148198856 -9 Left 1148198850 17:45734538-45734560 CCAGCCTCAGGAATGACTTAAAC 0: 1
1: 0
2: 1
3: 20
4: 270
Right 1148198856 17:45734552-45734574 GACTTAAACCAGGGACTCTGGGG 0: 1
1: 0
2: 1
3: 26
4: 715
1148198850_1148198855 -10 Left 1148198850 17:45734538-45734560 CCAGCCTCAGGAATGACTTAAAC 0: 1
1: 0
2: 1
3: 20
4: 270
Right 1148198855 17:45734551-45734573 TGACTTAAACCAGGGACTCTGGG 0: 1
1: 1
2: 0
3: 17
4: 189
1148198850_1148198861 18 Left 1148198850 17:45734538-45734560 CCAGCCTCAGGAATGACTTAAAC 0: 1
1: 0
2: 1
3: 20
4: 270
Right 1148198861 17:45734579-45734601 CAGGCATCCCTCCTACTGCCTGG 0: 1
1: 0
2: 3
3: 17
4: 248
1148198850_1148198864 27 Left 1148198850 17:45734538-45734560 CCAGCCTCAGGAATGACTTAAAC 0: 1
1: 0
2: 1
3: 20
4: 270
Right 1148198864 17:45734588-45734610 CTCCTACTGCCTGGTTCTCTAGG 0: 1
1: 0
2: 2
3: 39
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148198850 Original CRISPR GTTTAAGTCATTCCTGAGGC TGG (reversed) Intergenic