ID: 1148199211

View in Genome Browser
Species Human (GRCh38)
Location 17:45738100-45738122
Sequence GGAGCCAGAGTGTGCAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148199211_1148199216 23 Left 1148199211 17:45738100-45738122 CCATCTCTGCACACTCTGGCTCC No data
Right 1148199216 17:45738146-45738168 AAGTAGCCTGAGGCCCTCGTCGG No data
1148199211_1148199215 13 Left 1148199211 17:45738100-45738122 CCATCTCTGCACACTCTGGCTCC No data
Right 1148199215 17:45738136-45738158 CTATGAGCAGAAGTAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148199211 Original CRISPR GGAGCCAGAGTGTGCAGAGA TGG (reversed) Intergenic
No off target data available for this crispr