ID: 1148199213

View in Genome Browser
Species Human (GRCh38)
Location 17:45738122-45738144
Sequence TGCTCATAGCAGAAGGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2877
Summary {0: 3, 1: 8, 2: 81, 3: 452, 4: 2333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148199213_1148199216 1 Left 1148199213 17:45738122-45738144 CCTTTTGCCTTCTGCTATGAGCA 0: 3
1: 8
2: 81
3: 452
4: 2333
Right 1148199216 17:45738146-45738168 AAGTAGCCTGAGGCCCTCGTCGG No data
1148199213_1148199215 -9 Left 1148199213 17:45738122-45738144 CCTTTTGCCTTCTGCTATGAGCA 0: 3
1: 8
2: 81
3: 452
4: 2333
Right 1148199215 17:45738136-45738158 CTATGAGCAGAAGTAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148199213 Original CRISPR TGCTCATAGCAGAAGGCAAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr