ID: 1148199216

View in Genome Browser
Species Human (GRCh38)
Location 17:45738146-45738168
Sequence AAGTAGCCTGAGGCCCTCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148199213_1148199216 1 Left 1148199213 17:45738122-45738144 CCTTTTGCCTTCTGCTATGAGCA 0: 3
1: 8
2: 81
3: 452
4: 2333
Right 1148199216 17:45738146-45738168 AAGTAGCCTGAGGCCCTCGTCGG No data
1148199212_1148199216 2 Left 1148199212 17:45738121-45738143 CCCTTTTGCCTTCTGCTATGAGC No data
Right 1148199216 17:45738146-45738168 AAGTAGCCTGAGGCCCTCGTCGG No data
1148199211_1148199216 23 Left 1148199211 17:45738100-45738122 CCATCTCTGCACACTCTGGCTCC No data
Right 1148199216 17:45738146-45738168 AAGTAGCCTGAGGCCCTCGTCGG No data
1148199214_1148199216 -6 Left 1148199214 17:45738129-45738151 CCTTCTGCTATGAGCAGAAGTAG No data
Right 1148199216 17:45738146-45738168 AAGTAGCCTGAGGCCCTCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148199216 Original CRISPR AAGTAGCCTGAGGCCCTCGT CGG Intergenic
No off target data available for this crispr