ID: 1148206971

View in Genome Browser
Species Human (GRCh38)
Location 17:45785033-45785055
Sequence CGCCGCGGAGGGGAAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 568}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148206971_1148206978 -9 Left 1148206971 17:45785033-45785055 CCTGCCCCTTCCCCTCCGCGGCG 0: 1
1: 0
2: 3
3: 61
4: 568
Right 1148206978 17:45785047-45785069 TCCGCGGCGAGCTGCGAGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148206971 Original CRISPR CGCCGCGGAGGGGAAGGGGC AGG (reversed) Intronic
900121096 1:1049062-1049084 GGGCGGGGAGGGGACGGGGCCGG + Intronic
900139274 1:1132704-1132726 AGCCTCGGAGGGGGAGGGGAAGG + Intergenic
900201254 1:1407606-1407628 CGGCGCGGGCGGGGAGGGGCAGG + Intergenic
900368612 1:2321615-2321637 GGCCAGGGAGGGGAAGGGACAGG - Intronic
900433078 1:2612037-2612059 CTCCGTGGAGGGGCAGGGGCTGG - Intronic
900487678 1:2931164-2931186 GGCCTGGGAGGGGACGGGGCTGG + Intergenic
900532689 1:3162490-3162512 CTCAGCCGGGGGGAAGGGGCAGG - Intronic
900789079 1:4667362-4667384 CCCCACGGAGGGGCAGGGGCAGG - Intronic
902042976 1:13505886-13505908 GGCCTGGGTGGGGAAGGGGCAGG + Intronic
902214121 1:14924039-14924061 CGCCGCGGCGGGGCGGGGGCGGG + Intronic
902323709 1:15684703-15684725 GGTCGCGGAGGGGAAGGGCGGGG - Intronic
902637344 1:17743300-17743322 AGGCGGGGAGGGGAGGGGGCCGG + Intergenic
902940959 1:19799924-19799946 CGGCGGGGAGGGGAGGGGCCGGG - Intronic
903504760 1:23825487-23825509 CACGGCGGAGGGGCGGGGGCGGG - Intronic
903616979 1:24666873-24666895 CGCCGTCGAGGAGGAGGGGCGGG - Exonic
904044884 1:27603174-27603196 CGCCGGGAAGGGGGAGGGGGAGG - Intronic
904619292 1:31765806-31765828 CGCAGCGAAAGGGAAGGTGCCGG - Intergenic
904773470 1:32893625-32893647 CGACGGTGAGGGGCAGGGGCGGG + Exonic
905108348 1:35577149-35577171 AGCAGCAAAGGGGAAGGGGCAGG + Intronic
905369287 1:37474654-37474676 GGCCTCGGCGGGGAAGCGGCAGG + Intronic
905548620 1:38818593-38818615 CGGTGCGGAGTGGATGGGGCGGG - Intergenic
905773627 1:40654152-40654174 GGGCGGGGAGGGGGAGGGGCGGG - Intronic
905791540 1:40792197-40792219 CCCCTGGGAGGGGAGGGGGCAGG + Intronic
905861931 1:41357771-41357793 TGGAGGGGAGGGGAAGGGGCTGG - Intergenic
907091506 1:51729782-51729804 CGCCGGGGAGGGGACGGGAAAGG + Intronic
907188998 1:52633276-52633298 CCGCGCGGAGGGGTAGGGGCAGG - Intergenic
907294273 1:53439582-53439604 CGTGCTGGAGGGGAAGGGGCGGG - Intergenic
910876924 1:91886329-91886351 AGCCGCGGAGGCAAAGGGGGAGG - Intronic
911078991 1:93909505-93909527 TCCCGCGGCGGGGCAGGGGCGGG + Intergenic
911370525 1:96989474-96989496 CCCAGCAGAGGGGAATGGGCAGG + Intergenic
911618355 1:100038606-100038628 CGCCGCGGGGAGGAATGTGCGGG + Intronic
912492715 1:110070734-110070756 CGCCGCGGGGGGCGGGGGGCGGG + Intronic
913161824 1:116152167-116152189 CGCCGCGGCTCGGAAGCGGCAGG + Intergenic
913975365 1:143450998-143451020 CGCCACTGAGGGGCTGGGGCAGG + Intergenic
913997092 1:143660589-143660611 CCCCGCTGAGGGGAGGGGGAGGG - Intergenic
914069755 1:144276614-144276636 CGCCACTGAGGGGCTGGGGCAGG + Intergenic
914095431 1:144540527-144540549 CCCCGGGGAGGGCAACGGGCAGG + Intergenic
914109400 1:144689740-144689762 CGCCACTGAGGGGCTGGGGCAGG - Intergenic
914303094 1:146393366-146393388 CCCCGGGGAGGGCAACGGGCAGG - Intergenic
914694710 1:150067024-150067046 CGCCGAGGCGGGGGCGGGGCAGG + Intergenic
914845901 1:151283271-151283293 CGCAGAGGAGGGCGAGGGGCTGG - Intronic
915490064 1:156245873-156245895 CGACGCGAAGGGGTAGAGGCAGG + Exonic
915913969 1:159930367-159930389 CCCCGCGGAGGGGACAGGGGAGG + Exonic
917683428 1:177391608-177391630 GGAAGAGGAGGGGAAGGGGCTGG + Intergenic
920021185 1:202957974-202957996 CGGCGCGCAGTGGGAGGGGCCGG + Intronic
920311735 1:205052656-205052678 GACAGCTGAGGGGAAGGGGCAGG + Intronic
920385658 1:205568958-205568980 CGCGGCGGGGAGGGAGGGGCGGG - Exonic
921024090 1:211260727-211260749 AGCCGCGGAGAGAAAGGGGTGGG + Intronic
921060445 1:211579662-211579684 CTCGGCGGCGGGGGAGGGGCCGG + Intergenic
924178686 1:241419152-241419174 GGTGGCGGAGGGGAAGAGGCAGG + Intergenic
924436554 1:244048602-244048624 CGCGGGGGAGGGGGAGGGGAGGG - Intergenic
1062885348 10:1011820-1011842 CACTGCAGAGGGGAAGAGGCTGG - Intronic
1062960985 10:1573589-1573611 GGCCTGGGAGGGGAAGGGGGAGG - Intronic
1063407618 10:5812815-5812837 CGAGGCGGAGGGGACGGTGCAGG - Intronic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1064274191 10:13891761-13891783 GGCGGCGGCGGGGACGGGGCGGG - Intronic
1065965418 10:30766626-30766648 CGCTGGGGAGGGGACAGGGCGGG - Intergenic
1066001052 10:31104284-31104306 CGCAGCGGAGAGTGAGGGGCTGG - Intergenic
1066460476 10:35608318-35608340 CGCGCCGGAGGGGAGGGGGCTGG + Exonic
1067039873 10:42943625-42943647 CACCACGGGGTGGAAGGGGCTGG - Intergenic
1067271573 10:44796112-44796134 CACAGCGGAGGGGATGGGGTGGG + Intergenic
1068989189 10:63133554-63133576 CGACGCGCCGGGGACGGGGCCGG - Intronic
1069386110 10:67884753-67884775 CGCCGCCGAGGGGGAGCCGCCGG - Exonic
1070701398 10:78604095-78604117 AGCCAGGGAAGGGAAGGGGCTGG + Intergenic
1071086777 10:81875114-81875136 AGCGGGGGAGGGGACGGGGCCGG - Intergenic
1071374487 10:84988710-84988732 GGCTGGGGAAGGGAAGGGGCGGG - Intergenic
1073043304 10:100621773-100621795 CGCGGAGGAGGGGAAGGGGGTGG + Intergenic
1073325443 10:102642301-102642323 CGCGGTGGGGGGGAAGGGGCGGG - Intergenic
1073491445 10:103855608-103855630 CGTCGGCGAGGGGACGGGGCGGG + Intergenic
1073820683 10:107260133-107260155 GGCCTCGGAGGGGAAAGGGTGGG + Intergenic
1074156893 10:110807481-110807503 CACCCCTGAGGGGAAGGGCCTGG + Intronic
1074363245 10:112839206-112839228 CCCTGAGGAGGGAAAGGGGCTGG - Intergenic
1075040711 10:119104598-119104620 CGGCGCGGCGGGGAGGAGGCAGG + Intronic
1075147217 10:119892624-119892646 CGCCGTGTAGGGGAAGGGAGAGG + Intergenic
1075599885 10:123759774-123759796 CACCGTGGAGGAGAAGGTGCAGG + Intronic
1076116964 10:127907445-127907467 CGCCGCGGGGGCGGCGGGGCCGG - Intronic
1076279337 10:129232523-129232545 CCCCGGGCAGGGGCAGGGGCAGG - Intergenic
1076850079 10:133088348-133088370 CGCCGCGGCCGGGCTGGGGCGGG + Intronic
1077205524 11:1341326-1341348 CTCTGGGGAGGTGAAGGGGCTGG - Intergenic
1077253554 11:1571253-1571275 CGCGGCGCTGGGGGAGGGGCTGG - Intronic
1077273476 11:1692626-1692648 CCCCGGGGAGGGGCAGGGGCTGG + Intergenic
1077359209 11:2133221-2133243 GTCCTGGGAGGGGAAGGGGCTGG + Exonic
1077441688 11:2571902-2571924 CGCCTGGGAGGGGCAGGGGCAGG + Intronic
1077514226 11:2992113-2992135 CGGGGCGGTGGGGCAGGGGCGGG - Intronic
1077601957 11:3580632-3580654 CCCCTAGCAGGGGAAGGGGCGGG - Intergenic
1077886277 11:6390364-6390386 CGCTGCGGAGGCGGAGGGGGCGG - Intergenic
1078317313 11:10304568-10304590 TCCCGCGGAGGGGCCGGGGCAGG - Intergenic
1078741856 11:14073968-14073990 CTCTGTGGAGGGGAAGGGGCAGG - Intronic
1078987021 11:16606968-16606990 CGACGCGGAGGGGGAGTGGAGGG - Intronic
1079229128 11:18634414-18634436 GGCCGTGGAGGGAAGGGGGCGGG - Exonic
1079451345 11:20601887-20601909 CGCCAAGGCTGGGAAGGGGCAGG - Intronic
1081938167 11:46918657-46918679 GGCCGAGGGCGGGAAGGGGCCGG - Intergenic
1082013653 11:47468146-47468168 TGGGGCTGAGGGGAAGGGGCAGG + Intronic
1082025113 11:47565823-47565845 CGGAGCGGCGGGGACGGGGCAGG - Intronic
1083610340 11:64001248-64001270 CGCCAGAGAGGGGAAGGGGCAGG - Intronic
1083625934 11:64071962-64071984 AGCTGCCGAGGGGAACGGGCTGG + Intronic
1083753735 11:64778192-64778214 CGCCGCGAAGGGGAAGGCCGCGG + Exonic
1083799421 11:65037940-65037962 GGCCTCTGAGGGGAAGGTGCGGG - Intronic
1083802923 11:65057322-65057344 GGCCTCGGTGAGGAAGGGGCTGG - Intronic
1083939608 11:65888561-65888583 AGTCGGGGAGGGGACGGGGCGGG + Intergenic
1084014824 11:66371965-66371987 TGCGGCGGAGGGGAAGGCGGGGG + Intronic
1084035768 11:66509328-66509350 GGCTGGGGAGGGGGAGGGGCAGG + Exonic
1084177945 11:67433228-67433250 CCCCGGGGAGGAGGAGGGGCAGG + Intronic
1084257866 11:67955178-67955200 CCCCTAGCAGGGGAAGGGGCGGG - Intergenic
1084493526 11:69490885-69490907 GGCGGTGGAGGGGCAGGGGCAGG - Intergenic
1084520741 11:69661194-69661216 CGCCACTGAGGGCAAGTGGCGGG - Intronic
1085043926 11:73342798-73342820 TGCCGCGTGGGGGAAGGGGCGGG + Intronic
1085400419 11:76232596-76232618 TGGAGCAGAGGGGAAGGGGCAGG - Intergenic
1086001559 11:81990908-81990930 CACGGCTGGGGGGAAGGGGCAGG + Intergenic
1086450019 11:86906424-86906446 CGCCGGGGTGGCGCAGGGGCGGG - Intronic
1088103281 11:106177490-106177512 TGCCGTGGAGGGGGAGGGGGAGG + Intergenic
1088889961 11:114036495-114036517 CGCTGCGGAAGGGTGGGGGCGGG - Intergenic
1089500664 11:118929580-118929602 AGCCGCGGAGGGGGAGGAGGGGG - Intronic
1090636699 11:128694314-128694336 GGCCGGGGAGGCGAAGCGGCGGG + Intronic
1090887599 11:130892960-130892982 GTCCGTGGAGGGGAAAGGGCAGG + Intronic
1090974598 11:131670849-131670871 GGGAGCAGAGGGGAAGGGGCTGG - Intronic
1091238563 11:134037387-134037409 CGCCGCGGAGGGGAGGGCGGTGG + Intergenic
1091571539 12:1691144-1691166 CACCGCTGAGGGGAGGGGGGAGG - Exonic
1091616424 12:2053817-2053839 GGGCCCGGAGGGGGAGGGGCGGG - Intronic
1094025794 12:25958817-25958839 CGCCGCGGGCGGGAAGGGCGAGG - Intergenic
1095085288 12:38053424-38053446 CGCCGGTGAGGGGTAGGGGAAGG + Intergenic
1096077576 12:48814902-48814924 CTCCGCGAAGGGGAAGGGCGAGG - Intronic
1096241325 12:49961794-49961816 CGGCGCGGGGGGGCAGGGGGCGG - Intergenic
1096489633 12:52006723-52006745 AGCCGCGGACGCGAAGGGGCGGG - Intergenic
1097107895 12:56635922-56635944 CGGGGCGGCGGGGAGGGGGCTGG + Intronic
1098016407 12:66109079-66109101 GGCCGGGGAAGGGAAGGGGAGGG + Intergenic
1098426112 12:70366680-70366702 CGCCGGGGGCGGGAGGGGGCGGG + Exonic
1098897833 12:76084022-76084044 CCCCGAGGCGGGGAGGGGGCGGG - Intronic
1100391379 12:94148653-94148675 AGGCGCGGAGGGGAAGGGAGGGG - Intergenic
1100618411 12:96249383-96249405 CACTGCGGAGGGGGAGGGCCAGG + Intronic
1100982553 12:100172949-100172971 GGCTGCTGAGGGGGAGGGGCTGG + Intergenic
1101910552 12:108857622-108857644 CGACGCCGAGGGGGAGGGGCGGG - Intergenic
1102003564 12:109573831-109573853 CGGCGCGGAGGGGCGGCGGCCGG + Exonic
1102084355 12:110124198-110124220 CGGAGCGGACGGGACGGGGCGGG - Intergenic
1102084368 12:110124227-110124249 CGGGGCGGAGCGGACGGGGCGGG - Intergenic
1102997477 12:117361321-117361343 CAAAGCGGAGGGGAAGGGGAGGG - Intronic
1103309021 12:119989687-119989709 CGCCGGCGCGGGGGAGGGGCGGG + Intergenic
1103392548 12:120584834-120584856 GGCCGCGAAGGGGCAGCGGCGGG + Intergenic
1103410800 12:120710385-120710407 GGGCCCGGCGGGGAAGGGGCGGG - Intergenic
1103705112 12:122867232-122867254 CCACGCGGGGGGGCAGGGGCGGG + Exonic
1104316350 12:127706126-127706148 ACCCGGGGAGGGGAAGGGGGAGG - Intergenic
1104506532 12:129337576-129337598 CTCGGGGGAGGGGAAGGCGCCGG - Intronic
1104935316 12:132361243-132361265 CGCCGCGGAGGGGCTGTGGAGGG - Intergenic
1104947614 12:132423589-132423611 GTCCGCGGAGGGAGAGGGGCAGG + Intergenic
1105699281 13:22923865-22923887 CGGGGTGGAGGGGAAGGGGAGGG + Intergenic
1106447527 13:29850125-29850147 CGCCGCGGGGGCGAAGAGCCGGG + Exonic
1106720010 13:32427554-32427576 CACGGCGGCGGGGAAGGGGCCGG + Intronic
1107842648 13:44474977-44474999 AGCAGAGGTGGGGAAGGGGCGGG + Intronic
1108733370 13:53257540-53257562 CCCTGGGGAGTGGAAGGGGCAGG - Intergenic
1112051167 13:95644647-95644669 GATCGCGGAGGGGAGGGGGCGGG - Intronic
1113899341 13:113788023-113788045 TGCCGCAGAGGGGAAGGCGGAGG + Intronic
1113940771 13:114017619-114017641 GGCCGCAGAGGGGAGAGGGCGGG - Intronic
1115566642 14:34630197-34630219 CGGGGCGGAGGCGAAGGGGCGGG + Intergenic
1115761603 14:36582390-36582412 GGCCGAGGAGGGGAAGGAGGCGG + Exonic
1116657953 14:47674903-47674925 CGCCGGGGAGGAGCAGGGGGCGG + Exonic
1116916627 14:50532230-50532252 CGGGACGGAAGGGAAGGGGCCGG - Intronic
1117135505 14:52730715-52730737 CCCCGCGGAGGGGCAGCGTCTGG + Intronic
1118350994 14:64972356-64972378 GGCGGCGCAGGGGAAGGGGCGGG - Intronic
1118854615 14:69611543-69611565 CCCCGCGGAGGGGAGGGGGCGGG - Intergenic
1121021905 14:90585357-90585379 GGCAGCGGAGGGGATGGGTCAGG - Intronic
1121342957 14:93115909-93115931 CGCGGCGGCGAGGAAGCGGCGGG + Intronic
1121473425 14:94174185-94174207 CGCGGCGCCCGGGAAGGGGCGGG + Intronic
1122137853 14:99645124-99645146 CGCGGCGGCAGGGAAGGGGCGGG - Exonic
1122430217 14:101635565-101635587 CTCCGGGGAGGGGACCGGGCGGG + Intergenic
1122544846 14:102516754-102516776 GCCCGAGGCGGGGAAGGGGCCGG + Intergenic
1122782241 14:104148656-104148678 GGCCGGGGAGGGGGAGGGGGAGG + Intronic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1122931320 14:104933999-104934021 CGCGGCTGAGGGGACGGGGAGGG + Exonic
1122931336 14:104934034-104934056 CGCGGCTGAGGGGACGGGGAGGG + Exonic
1122986894 14:105216586-105216608 CCCAGGGGAGGGGCAGGGGCAGG + Intronic
1123004486 14:105314787-105314809 GGCGGCGGAGGGGACGGGCCGGG - Exonic
1124453876 15:29822560-29822582 GGCCGCGGCGGGGGAGGGGGCGG + Intronic
1124612232 15:31216212-31216234 GGAGGCGGAGGGGAAGGGGGAGG + Intergenic
1124696378 15:31867897-31867919 GGGAGCGGAGGGGGAGGGGCGGG + Intronic
1124696906 15:31870856-31870878 GGCCCCGGAGGGGCGGGGGCGGG - Intergenic
1125594236 15:40874069-40874091 CGCCGCCGCGGGGGAGGGGTCGG + Exonic
1129228787 15:74184930-74184952 CGCCGAGGTGGGGAAGGAGTGGG - Intronic
1129540272 15:76342602-76342624 CGCGGCCGAGGGGGTGGGGCTGG + Intergenic
1131260303 15:90884400-90884422 GCCTGTGGAGGGGAAGGGGCGGG - Exonic
1131423455 15:92326427-92326449 CCCAGGGGAGGGGGAGGGGCCGG + Intergenic
1131990499 15:98088645-98088667 CCTGGGGGAGGGGAAGGGGCCGG - Intergenic
1132099645 15:99014652-99014674 CCTGGGGGAGGGGAAGGGGCCGG + Intergenic
1132378411 15:101348172-101348194 AGCAGCGGAGGCGCAGGGGCCGG - Intronic
1132618733 16:854630-854652 CGCCGCCGAGGGCAAGTGGTGGG - Exonic
1132709730 16:1261131-1261153 TGCCGGGGTGGGGAAGGGGCCGG - Intergenic
1132851479 16:2026818-2026840 GGCGGGGGCGGGGAAGGGGCGGG + Intronic
1132854407 16:2038493-2038515 CGCTGCTGAGGGGAGGGGGCGGG - Exonic
1132885847 16:2181635-2181657 GGAGGCGGAGGGGCAGGGGCCGG + Intronic
1132932962 16:2468107-2468129 CTCGGCGGAGGCGAAGGGCCGGG + Intergenic
1133218463 16:4307646-4307668 CCCCGCGTGGGGGTAGGGGCGGG + Intergenic
1133295350 16:4749174-4749196 GGCCCCGGAGTGGAGGGGGCAGG - Exonic
1133370135 16:5240395-5240417 CCCCCAGCAGGGGAAGGGGCGGG + Intergenic
1133464745 16:6018982-6019004 CGCTGGCGAGGGGAAGGGGGAGG + Intergenic
1134256295 16:12614596-12614618 CGGCGCGGTGGGGGAGGGGCGGG - Intergenic
1134549463 16:15132320-15132342 CGGAGGGGAGGGGAGGGGGCAGG + Intronic
1136220044 16:28823060-28823082 CGCCGCGAGGCGGAAGGGGAGGG - Intronic
1136233851 16:28903009-28903031 GGCTGCAGAGGGGAAGGGGAGGG - Exonic
1136381814 16:29899470-29899492 TGTCGGGGAGGGGAAGGGGTGGG + Exonic
1137426339 16:48384716-48384738 CGCCGCGGGGAGGAGGGGGAGGG + Intronic
1137926713 16:52547311-52547333 CGCGGCGGGGGTGATGGGGCCGG - Intronic
1138265236 16:55655845-55655867 GGCCGGGGATGGGCAGGGGCGGG - Intronic
1138381871 16:56608343-56608365 CGCCTCGGCGCGGAAGGGGCTGG - Exonic
1138417591 16:56880069-56880091 CCCAGGGGAGGGGAAGTGGCAGG + Intronic
1140376962 16:74452404-74452426 AGCTGGGGAGGGGAAGGGACCGG - Intronic
1140418619 16:74797223-74797245 AGCTGCAGAGGGGAATGGGCAGG + Intergenic
1140753339 16:78045960-78045982 GGGCGCGGAGACGAAGGGGCCGG + Intronic
1141644226 16:85358683-85358705 CTCCGGGGAAGGGAAGGGGCTGG + Intronic
1141694218 16:85612227-85612249 CGCCGCGATGGGGTGGGGGCGGG + Intronic
1142034167 16:87853600-87853622 CGCTGCACAGGGCAAGGGGCAGG + Intronic
1142092979 16:88225070-88225092 AGGCACTGAGGGGAAGGGGCAGG - Intergenic
1142155468 16:88530974-88530996 GGCCGCAGAGGGGAGGGCGCGGG + Intronic
1142307467 16:89293632-89293654 GGCTGCGGAGGGGAGGAGGCGGG + Intronic
1142514175 17:416224-416246 CTCCATGGAGAGGAAGGGGCAGG + Intronic
1142586975 17:979847-979869 GGCCGCGGAGGGGGCGTGGCAGG - Intergenic
1142758708 17:2030507-2030529 CGACGGGGAGGGAAAGGGCCAGG + Intronic
1142763440 17:2053946-2053968 CACCGCGGAGCGCGAGGGGCTGG - Intergenic
1143409184 17:6698198-6698220 CGTCGGGAAGGGGAAGGGGTGGG + Intronic
1143559692 17:7686152-7686174 CGTCGTGAAGCGGAAGGGGCGGG - Intronic
1143783373 17:9240736-9240758 CGCTGGGCAGGGGCAGGGGCAGG - Exonic
1144758561 17:17694614-17694636 CGCCGCGGGCGGGGAGGGGCGGG - Intronic
1144764479 17:17725115-17725137 CGCCGGGGCAGGGAGGGGGCTGG + Intronic
1144787589 17:17840476-17840498 CGCCGAGGTCGGGCAGGGGCCGG - Intergenic
1145041373 17:19580158-19580180 CGCCGCGCAGGGGTGGGCGCGGG + Intergenic
1145205200 17:20981133-20981155 AGCAGCTGAGGGGCAGGGGCTGG + Intergenic
1145266540 17:21382370-21382392 GGCGGCTGAGGGGATGGGGCTGG + Intronic
1145291724 17:21551694-21551716 CGGGGCGGAGGAGACGGGGCGGG + Intronic
1145291734 17:21551713-21551735 CGGGGCGGAGGGGACGGGGCGGG + Intronic
1145388312 17:22435261-22435283 CGGGGTGGAGGGGACGGGGCGGG - Intergenic
1145388341 17:22435333-22435355 CGGGGCGGAGGGGACGAGGCAGG - Intergenic
1145876167 17:28319547-28319569 CGCCGCTTGGGAGAAGGGGCTGG - Intronic
1145915424 17:28571236-28571258 CTCCGCGTCGGGGATGGGGCCGG - Intronic
1146062383 17:29614087-29614109 TGCCGGGGTGGGGGAGGGGCTGG - Exonic
1146172878 17:30646610-30646632 CGGCGAGGTCGGGAAGGGGCTGG - Intergenic
1146255941 17:31391658-31391680 CGCTCCGGAGGGGAAGGGAGGGG - Exonic
1146271369 17:31487963-31487985 CGCCGGGGCGGGGCGGGGGCGGG - Intronic
1146332330 17:31937407-31937429 CGCCGCGGAGGAGGAGGAGGAGG - Exonic
1146346335 17:32062605-32062627 CGGCGAGGTCGGGAAGGGGCTGG - Intergenic
1147015795 17:37490207-37490229 CGGCGCGGCGGGGGAGCGGCAGG - Intronic
1147168435 17:38605244-38605266 TGCAGGGGAGGGGAAGGGGATGG - Intronic
1147285772 17:39401715-39401737 CGCCCGGGAGGGGGAGGGGCGGG + Intronic
1147400378 17:40177402-40177424 AGCCGAGGAAGGGTAGGGGCGGG + Intronic
1148206971 17:45785033-45785055 CGCCGCGGAGGGGAAGGGGCAGG - Intronic
1148502198 17:48100687-48100709 GGACACGGAGGGGGAGGGGCAGG - Intronic
1148783776 17:50135435-50135457 CACCGGGGGGCGGAAGGGGCTGG - Intronic
1149315161 17:55431917-55431939 GGCAGGGGAGGGGAAGGGGAGGG + Intergenic
1149597901 17:57874862-57874884 CGGGGGCGAGGGGAAGGGGCGGG + Intronic
1149626360 17:58083359-58083381 CGCGGCGGGGGGGCGGGGGCGGG + Intergenic
1149914944 17:60600290-60600312 CGCCGAGAAGGGGGAGGGGGCGG - Exonic
1150207572 17:63420573-63420595 CTCCGGAGAGGGGAAGGGGGAGG - Exonic
1150248650 17:63694014-63694036 CAGCGTGGAGGGGTAGGGGCTGG + Exonic
1150823877 17:68457583-68457605 GGACGCGGCGGGGACGGGGCGGG - Intergenic
1151318258 17:73337190-73337212 GGGCGGGGAGGGGAAGGGGCAGG - Exonic
1151558646 17:74859712-74859734 TGCTGCGGAGGGGAGGGGGCGGG - Intronic
1151567163 17:74905116-74905138 AGACCCAGAGGGGAAGGGGCTGG - Intergenic
1152042111 17:77910114-77910136 GGCGGAGAAGGGGAAGGGGCAGG - Intergenic
1152078866 17:78174418-78174440 AGCCGCAGAGGGGAAGAAGCAGG + Exonic
1152361529 17:79835293-79835315 GGGCGCGCAGGGGAAGGGCCAGG - Exonic
1152362635 17:79839615-79839637 GGACGCGGAGGGGAGGGCGCCGG + Intergenic
1152362643 17:79839632-79839654 CGCCGGGGAGGTGCAGGGGGAGG + Intergenic
1152406705 17:80101968-80101990 CTCCGCTCAGGGGAAGAGGCTGG - Intergenic
1152425152 17:80214577-80214599 GGCCGCCAGGGGGAAGGGGCAGG + Intronic
1152654952 17:81515019-81515041 CGCCTCCGAGGGGTCGGGGCGGG + Intronic
1152702073 17:81824167-81824189 TGCCCTGGAGGGGCAGGGGCAGG + Intronic
1152757087 17:82091558-82091580 CGCCACGGACGGGCAGGGGCTGG + Exonic
1152845456 17:82597008-82597030 AGCCGGTGAGGGGCAGGGGCTGG + Intronic
1152853105 17:82648841-82648863 CGGGGAGGAGGGGGAGGGGCGGG + Intergenic
1153634727 18:7103874-7103896 CGCTGGGGAGGGGCAGGGGCTGG - Intronic
1153688573 18:7568526-7568548 GGCCGCGGAGGGAAGCGGGCAGG + Intronic
1154230636 18:12553135-12553157 CACCACAGCGGGGAAGGGGCTGG - Intronic
1154294476 18:13136957-13136979 GAGCGCGGAGGGGAAGGTGCGGG - Intergenic
1156253880 18:35377104-35377126 GGCAGCGGAGGGGAGGGGCCTGG + Intronic
1156338073 18:36187360-36187382 CGCCCAGGTGGGGAAAGGGCTGG + Intergenic
1157354002 18:46917149-46917171 CGCGGGGGAGGGGAGCGGGCCGG - Intronic
1157529553 18:48409573-48409595 CCGCGCGGCGGGGAGGGGGCGGG - Intronic
1157618558 18:49002177-49002199 AGCCTCGGAGGGGAGCGGGCAGG + Intergenic
1159040603 18:63320109-63320131 CGGCGCGGAGGGGCGGGCGCGGG + Exonic
1160164304 18:76496161-76496183 CGCGGGGGCGGGGGAGGGGCGGG + Intronic
1160236116 18:77087899-77087921 CGCGGGGCAGGGGATGGGGCAGG + Intronic
1160679993 19:408163-408185 CCCCGCGGAGGGCGAGGGACAGG - Exonic
1160688226 19:447291-447313 CGCCGGGGATGGGGAGGGGGTGG + Intronic
1160719084 19:589812-589834 CCTCGCGGCGGGGGAGGGGCGGG - Intergenic
1160720238 19:594051-594073 CGCAGGAGAGGGGCAGGGGCTGG + Intronic
1160731633 19:643939-643961 CGGAGGGGAGGGGAGGGGGCCGG + Intergenic
1160760358 19:781090-781112 GGCCCCGGAGGGGCGGGGGCAGG + Intergenic
1160776907 19:860785-860807 CGCCGCGCGGGGGAAGAGCCCGG + Intronic
1160887006 19:1354829-1354851 CGCGGCGGAAGGGGCGGGGCCGG + Intronic
1160975367 19:1790158-1790180 GGCAGTGGAGGGGAAGGGGAGGG - Intronic
1160992342 19:1864855-1864877 CGCCGGAGCTGGGAAGGGGCGGG - Intergenic
1161315313 19:3614760-3614782 CACAGCGGAGGGGAGGGGGTGGG + Intronic
1161321492 19:3643681-3643703 CAGCGCGGAGGGGAAGGGAGGGG - Intronic
1161327564 19:3670963-3670985 CGCGGCGGGGCGGAAGGTGCTGG + Intronic
1161333851 19:3700492-3700514 CGGCGCGGGGCGGACGGGGCGGG + Intergenic
1161337566 19:3722567-3722589 CGCCGTGGCGGGGGCGGGGCGGG + Intronic
1161400856 19:4065809-4065831 CCCCGGGGCGGGGAGGGGGCCGG + Intronic
1161406977 19:4096184-4096206 TCCCGCGCAGGGGCAGGGGCGGG + Intronic
1161469439 19:4448976-4448998 CCTCGGGGAGGGGCAGGGGCTGG - Intronic
1161864166 19:6821787-6821809 CTCCTCGGTGGGGAAGGGCCTGG - Exonic
1162141000 19:8585551-8585573 TGCCGCGGAGGAGAAGGCGCTGG - Exonic
1162372973 19:10290021-10290043 CGCCGCGGCGGGGAAAGCACAGG - Exonic
1162402189 19:10453129-10453151 AGCCGCGGAGGGGCCTGGGCCGG - Intronic
1162497866 19:11033530-11033552 CGCTGGGGAGGGGTCGGGGCCGG - Intronic
1162751710 19:12833725-12833747 CGCTGGCGGGGGGAAGGGGCGGG - Intronic
1162773629 19:12965555-12965577 CTCCGTGGAGGGGAGGGCGCGGG + Intronic
1162777854 19:12990461-12990483 GGGCGCAGAGGGGAAGGGGCGGG - Intergenic
1163146197 19:15380385-15380407 CCCCGAGGAGGAGAAGGAGCAGG - Exonic
1163492768 19:17626584-17626606 GGCCGGGGAGGGGCTGGGGCAGG - Intronic
1163502830 19:17686766-17686788 TGCCGCGGCGGGGAGCGGGCGGG + Intronic
1163774917 19:19212297-19212319 CCCCCCGGTGGGGAGGGGGCCGG + Intronic
1164643697 19:29843730-29843752 CGGCCCTGAGGGGCAGGGGCAGG + Intergenic
1165072062 19:33261393-33261415 CTTAGCAGAGGGGAAGGGGCAGG - Intergenic
1165145373 19:33726943-33726965 AGCAGAGGAGGGGAAGGTGCAGG - Intronic
1165172360 19:33903162-33903184 CGGGGCGGGGGGGAAGGGGCGGG + Intergenic
1165758927 19:38309416-38309438 GGCCGCGCAGGGCAAGGAGCTGG - Exonic
1165861665 19:38912256-38912278 CGCCGCGGGCGGGGAGGGGGCGG - Intergenic
1166105967 19:40598210-40598232 AGCCGCGGCGGGGGCGGGGCCGG + Intronic
1166198068 19:41219509-41219531 CCCCTCGGAGGGGCTGGGGCAGG + Intronic
1166222821 19:41376664-41376686 CGCCGCGGAGGGACAGAGCCTGG + Exonic
1166222827 19:41376698-41376720 CGCGGGGGCGGGGACGGGGCGGG - Exonic
1166279985 19:41785807-41785829 AGTCGTGGAGGGGATGGGGCTGG + Intergenic
1166304090 19:41927996-41928018 CGCAGGGGCGGGGAGGGGGCGGG - Intronic
1166306901 19:41940407-41940429 CGCGGCGGCGGGGGAGGGGCGGG - Intergenic
1166892245 19:46000697-46000719 CCTAGAGGAGGGGAAGGGGCCGG + Intronic
1167417893 19:49386741-49386763 GGACGCGGAGGGGAAGGGAGGGG + Intergenic
1167643594 19:50694767-50694789 AGGAGCGGAGGGGAAGGGGCGGG + Intronic
1167943092 19:52963017-52963039 CGCGGGGGCGGGAAAGGGGCGGG + Intergenic
1168536159 19:57172233-57172255 CGCCGCGGAGAGGACGAGCCCGG - Intergenic
926282993 2:11465705-11465727 CGGCGCGGGGAGGAGGGGGCCGG + Intronic
926474704 2:13308284-13308306 CGCAGCGGCGGGGAACTGGCAGG - Intergenic
927459686 2:23287255-23287277 CACAGTGGAAGGGAAGGGGCTGG + Intergenic
928042320 2:27890697-27890719 GGCCGCAGAGGGGGCGGGGCGGG + Exonic
928948110 2:36790280-36790302 GGCAGAGGAGGGGAAGGGGATGG - Intronic
929581662 2:43085384-43085406 GGAGGAGGAGGGGAAGGGGCAGG - Intergenic
929966772 2:46542673-46542695 GGCGGCGGAGGGGAGGGGCCAGG - Intronic
930700862 2:54456814-54456836 CGCCGCGCCGGGGCTGGGGCCGG - Intronic
930723916 2:54664523-54664545 GGTCGGGGAGGGGATGGGGCTGG - Exonic
931348830 2:61470820-61470842 GGCGGCGGCGGGGACGGGGCGGG + Intergenic
932496409 2:72147866-72147888 GGCCGCGGCGGGGGAGGGGAGGG + Exonic
932699737 2:73984761-73984783 TCCCGCGGAGGGGAGGGGTCGGG - Intergenic
932699814 2:73984976-73984998 GGCCGAGGAGGGGACGGCGCAGG - Intergenic
932723425 2:74157157-74157179 CTCTGGGGAGGGGAAAGGGCTGG + Intronic
932801411 2:74745643-74745665 GGCCGCTGAGGTGTAGGGGCTGG + Intergenic
933776178 2:85772473-85772495 CGCCACGGAGGGCAGAGGGCAGG + Intronic
933937755 2:87219966-87219988 TGCGGTGGAGGGGCAGGGGCAGG + Intergenic
934180065 2:89611971-89611993 CGCCACTGAGGGGCTGGGGCAGG + Intergenic
934290358 2:91686232-91686254 CGCCACTGAGGGGCTGGGGCAGG + Intergenic
935046708 2:99489774-99489796 CGGCGGGGTGGGGGAGGGGCGGG - Intronic
935082144 2:99808547-99808569 CTCAGAGGAGGGGGAGGGGCAGG - Intronic
935446899 2:103166611-103166633 CTCTGCGGAGGGGAAGGGCCTGG + Intergenic
936104593 2:109613949-109613971 CTCCGCGACGGGGAAGGGACAGG + Exonic
936247673 2:110842768-110842790 AGGGGCGGAGGGGAAGGGGAAGG + Intronic
936355384 2:111745807-111745829 TGCGGTGGAGGGGCAGGGGCAGG - Intergenic
937271267 2:120654558-120654580 CGCGGCGGTGGGGCAGGGGGCGG + Intergenic
938077240 2:128346329-128346351 GGCCGCGGAGAAGAAGGGACGGG - Intergenic
938168816 2:129057016-129057038 AGCTGCAGAGGGGCAGGGGCAGG - Intergenic
939612962 2:144332359-144332381 CGCCGGGGAGGGGAGGGGAGGGG + Intronic
939648797 2:144736646-144736668 TGCCAGGGAGGGGAAGGAGCTGG - Intergenic
940353838 2:152717921-152717943 CGAGGCGGAGGGGAGGAGGCGGG + Exonic
941178950 2:162235185-162235207 CATGGCGGAGGGGGAGGGGCAGG - Intronic
942302029 2:174571906-174571928 GGCCGCGGAGTGGAAGGCACTGG + Exonic
942947182 2:181683789-181683811 CCGGGCGGAGGGGAAGGGGGAGG + Intergenic
946354964 2:219178642-219178664 CGCGGAGGAGGGGGCGGGGCCGG + Intronic
946358839 2:219206859-219206881 GGCGGGGGAGAGGAAGGGGCGGG + Exonic
947718118 2:232351963-232351985 CGCGCCGGTGAGGAAGGGGCGGG - Intergenic
947721284 2:232370523-232370545 TGGAGGGGAGGGGAAGGGGCTGG - Intergenic
947734779 2:232448906-232448928 TGGAGGGGAGGGGAAGGGGCTGG - Intergenic
947801083 2:232928665-232928687 CCTCGCGGTGGGGAGGGGGCCGG + Intronic
947992337 2:234497252-234497274 CGGCGCGGCGCGGGAGGGGCCGG - Intergenic
947992370 2:234497374-234497396 CGGCCCGGAGGGGCAGGGGGCGG - Intergenic
948781341 2:240323777-240323799 CTGCAAGGAGGGGAAGGGGCCGG + Intergenic
948806010 2:240453647-240453669 CGGCGGGGAGGGAAGGGGGCGGG - Intronic
948807800 2:240460483-240460505 AGCAGGAGAGGGGAAGGGGCAGG - Intronic
948874702 2:240820360-240820382 GGCCGCCGCGGGGATGGGGCTGG + Intergenic
949051930 2:241902315-241902337 GGCGGCGGAGGGGAGGCGGCAGG - Intronic
949064546 2:241981774-241981796 GGTGGCAGAGGGGAAGGGGCAGG + Intergenic
1169021790 20:2335950-2335972 CGCCTTGGAGGGGCATGGGCTGG - Intronic
1169231119 20:3889462-3889484 TGCTGCGGATGGGAGGGGGCCGG + Exonic
1170629651 20:18056500-18056522 CGCCGCCCAGGGGCAGGTGCAGG + Intronic
1170674544 20:18467112-18467134 CCCTGCGGAGCGGCAGGGGCCGG - Exonic
1170791223 20:19511132-19511154 AGGCAGGGAGGGGAAGGGGCTGG - Intronic
1170893799 20:20396560-20396582 CCCCGGGGAGGGGAAGGCCCAGG + Intronic
1170951354 20:20938961-20938983 GGCAGTGGAGGGGGAGGGGCGGG - Intergenic
1171043758 20:21791112-21791134 CACAGCAGAGCGGAAGGGGCAGG + Intergenic
1172117986 20:32583322-32583344 GGCCGCGGAGGGGGAGGGGGAGG + Intronic
1172422021 20:34825636-34825658 CGGCGGGGAGGGGGATGGGCCGG + Intronic
1172993434 20:39052398-39052420 TGCGGCAGAGGGGCAGGGGCAGG + Intergenic
1173251662 20:41366841-41366863 GGCCGCGGAGGGGAGGCGGGAGG + Intergenic
1173480274 20:43393152-43393174 AGCCTCGGAGGGGAAGGGAAGGG - Intergenic
1173727372 20:45307159-45307181 CGCGGCGGTGGGGTAGGAGCTGG - Intronic
1174246810 20:49188046-49188068 CGCCGCGGTGGGGAGGTGGGCGG - Intronic
1174804486 20:53593850-53593872 GGGCGCGGAGGGGAGGGGGCGGG + Intronic
1175349945 20:58310211-58310233 CTCCAGGGAGGGGAAGGGGAAGG - Intronic
1175429258 20:58890963-58890985 CGCCGCCGAGGGGCTGGGGTGGG - Intronic
1175734038 20:61372932-61372954 GGACGCGGAGGGCACGGGGCTGG - Intronic
1175859726 20:62143713-62143735 CGCGGAGGGGGGGAAGGGGGCGG - Intergenic
1175967349 20:62666142-62666164 TGCCTCAGAGGGGAAGGGGAAGG - Intronic
1175985967 20:62764344-62764366 CGGCTCGGAGGGGAAGGTGGGGG - Intergenic
1176014953 20:62926271-62926293 GGCCGCGGAAGGGAAGGAGCGGG - Intronic
1176093941 20:63331016-63331038 AGCCGCAGTGGGGAAGGGGAGGG + Intronic
1176221197 20:63970003-63970025 CTCCGCGACGGGGAGGGGGCGGG + Intronic
1176377835 21:6095571-6095593 CCACGCGGAGTGGAGGGGGCAGG + Intergenic
1176414663 21:6467672-6467694 CGGCGGGGTGGGGAAGGGGTGGG - Intergenic
1178318643 21:31588151-31588173 CGAAGGGGAGGGGAAGGGGAGGG + Intergenic
1178327921 21:31660114-31660136 GGCCGGGGAGGGGCGGGGGCGGG + Intronic
1178453738 21:32728069-32728091 CCCCGCGCGAGGGAAGGGGCGGG + Intergenic
1178915734 21:36704791-36704813 CGCGGCCGATGGGGAGGGGCAGG - Intronic
1179209474 21:39313331-39313353 CGGCGGGGAGGGGAGGGGGACGG + Intronic
1179690163 21:43075994-43076016 CGGCGGGGTGGGGAAGGGGTGGG - Intronic
1179745639 21:43442677-43442699 CCACGCGGAGTGGAGGGGGCAGG - Intergenic
1179911949 21:44455406-44455428 CGCGGGGGCGGGGAAGGGGCGGG - Intergenic
1180560389 22:16610252-16610274 GGGCGCGGAGGGGAGGGGGCGGG + Intergenic
1180649876 22:17369311-17369333 CGCCAGGGAGGGGGAGGGGCGGG - Intronic
1180953502 22:19731204-19731226 CACCGCCGCGGGGGAGGGGCGGG + Intergenic
1181082586 22:20424796-20424818 CGCCAGGGAAGGGAAGGGGTGGG + Exonic
1181174019 22:21025919-21025941 GGCCGGGGATGGGATGGGGCAGG + Intronic
1181440747 22:22934122-22934144 CTCTGCAGAGGGGCAGGGGCAGG + Intergenic
1181584426 22:23845269-23845291 GGCCACGGAAGGGAAGGAGCTGG - Intergenic
1181950208 22:26548356-26548378 GGCGGGGGAGGGGAAGGGGGAGG + Intronic
1181956379 22:26590203-26590225 CGCAGTGGAGGGGATGGGGCGGG - Intronic
1182144459 22:27988754-27988776 AGCCACGGAGGGGTCGGGGCGGG - Intronic
1182516479 22:30861907-30861929 CTCCAGGGAGAGGAAGGGGCAGG - Intronic
1182586198 22:31345647-31345669 CGCTGCTGAGGGGAAGGGAGGGG - Exonic
1183357252 22:37366416-37366438 GGCAGCTGAGGGGAAGGGCCTGG + Intergenic
1183535511 22:38398532-38398554 GGGCGCGGAGGGGAGGGGGCGGG + Intergenic
1183780176 22:39994686-39994708 CCCCGCGGAGGAGTCGGGGCCGG + Intergenic
1183829717 22:40411355-40411377 AGACGGGGTGGGGAAGGGGCTGG - Exonic
1184192137 22:42901917-42901939 CACCACGGAGAGGAAGGGCCAGG - Intronic
1184311768 22:43650142-43650164 CCTCCTGGAGGGGAAGGGGCAGG + Intronic
1184328583 22:43811310-43811332 GGGAGCGGAGGGGAAGGGGAGGG + Intronic
1184557457 22:45240964-45240986 GGCCGGGGCGGGGAAGGGGCGGG - Intergenic
1184796818 22:46737853-46737875 CGCCAGGGAGGGGTCGGGGCAGG - Intronic
1185055397 22:48576245-48576267 CGCCGCGGAGGGGGCGGGCGGGG - Intronic
1185254543 22:49825096-49825118 TGCCCCTGAGGGGAAGGGGCAGG - Intronic
1185363618 22:50424081-50424103 GGCTGAGGAGAGGAAGGGGCAGG + Intronic
950612560 3:14135563-14135585 CGCAGAGCAGGGGATGGGGCAGG - Intronic
950729850 3:14947824-14947846 CGGCGCGGAGGGCAGGGCGCGGG - Intronic
951485223 3:23202995-23203017 CGCGCCGGAGGAGGAGGGGCGGG + Intergenic
952316702 3:32238489-32238511 CGGCGCGGAGGAGAGGGCGCAGG - Intergenic
952316756 3:32238658-32238680 CCCGGAGGAGGGGAGGGGGCGGG - Exonic
952451878 3:33440418-33440440 CGCCGGGGCGGGGTCGGGGCGGG - Intronic
952781504 3:37104343-37104365 CGCAGTGGAGTGGAAAGGGCAGG - Intronic
952899772 3:38102324-38102346 CACCCAGCAGGGGAAGGGGCGGG - Intronic
953031224 3:39181062-39181084 CGCCGAGGAGGGGCGGGGGCGGG - Intergenic
953656932 3:44861767-44861789 CGCCTCGGAGGGGGCGGGCCAGG - Intronic
953908993 3:46882484-46882506 CCGCGCCGAGGGGAAGTGGCCGG + Intronic
954035373 3:47848390-47848412 CGGCGGGGCGGGGCAGGGGCTGG + Intronic
954200869 3:49022325-49022347 CCCTGCGGAGGGAAAGGGTCAGG - Exonic
954401683 3:50322558-50322580 CGCCCGGGAGGGTTAGGGGCTGG - Exonic
955348480 3:58177933-58177955 CCCTGCGGTGGGGAAGGCGCGGG + Intergenic
956553368 3:70488082-70488104 AGCCACGGAGGGGAAGGGCTCGG - Intergenic
957072795 3:75579666-75579688 CCCCCAGCAGGGGAAGGGGCGGG - Intergenic
957076981 3:75609897-75609919 AGCCAGGGAGGGGGAGGGGCTGG + Intergenic
957386473 3:79502492-79502514 CATGGCGGTGGGGAAGGGGCGGG - Intronic
961673423 3:128550611-128550633 AGCCGCGGAGGGGGTGGGGGAGG + Intergenic
961873098 3:130002494-130002516 CCCCCAGCAGGGGAAGGGGCGGG - Intergenic
961929378 3:130517106-130517128 CGCCGGGGCGGGGAAGGGTCGGG + Intergenic
962459011 3:135591636-135591658 CGCCACTTGGGGGAAGGGGCCGG + Intergenic
962740998 3:138362468-138362490 CTCAGAGGAGGGGAAGGGGATGG - Intronic
962869806 3:139478008-139478030 GGCCTGGTAGGGGAAGGGGCTGG + Intronic
965404143 3:168249572-168249594 CGCTCCGGAGGGGCTGGGGCGGG + Intergenic
965515744 3:169619422-169619444 CACCCAGGAGGGGAAGGGCCAGG - Intronic
965590599 3:170357547-170357569 CGGCGGGGAGGGGGAGGGGAAGG - Intergenic
966182288 3:177197847-177197869 CGCGGCGGTGGGGGCGGGGCGGG - Intergenic
966712037 3:182980734-182980756 GGGCGCGGCGGGGGAGGGGCGGG + Intronic
966762291 3:183428712-183428734 AGCCGCGGAGAGAAGGGGGCTGG + Intronic
967141741 3:186567335-186567357 CGCGGAGGAGGGTGAGGGGCGGG - Intronic
967166483 3:186784060-186784082 CGGCGCGGAGGCGACGGGACAGG + Intronic
967824777 3:193869490-193869512 AGCCGCCGAAGGGAAGGGCCCGG - Intergenic
968446113 4:653179-653201 CGCAGCGGAGGAGAGGGAGCTGG + Intronic
968511483 4:997692-997714 CGCTGGGGAGGGGACTGGGCCGG - Intronic
968541568 4:1170938-1170960 CCCCGCGGTGGGGACGGGGCTGG - Intronic
968584139 4:1408111-1408133 GGCGGGGGAGGGGAAGGGGAGGG - Intergenic
968602854 4:1518510-1518532 GGCTGCGGAGGGGACGGCGCAGG + Intergenic
968605565 4:1533558-1533580 CGCCGATGCGGTGAAGGGGCCGG + Intergenic
968646707 4:1744693-1744715 TGCCCTGGAGGGGTAGGGGCGGG - Exonic
968809325 4:2792972-2792994 CGCCGGGGAGGGGCGGGGCCGGG + Intergenic
968956376 4:3721811-3721833 CGCCCGGGAGGAGAGGGGGCAGG + Intergenic
969016407 4:4106976-4106998 CCCCCAGCAGGGGAAGGGGCGGG - Intergenic
969113362 4:4857066-4857088 CGCCGCGGGGGGGGGGGGGGGGG - Intergenic
969239153 4:5888089-5888111 CGCCGCGGGTGGGGCGGGGCCGG - Intronic
969240380 4:5893120-5893142 CGCCGGGGCGGGGCCGGGGCGGG + Intergenic
969617719 4:8263086-8263108 TGCAGCTGTGGGGAAGGGGCAGG + Intergenic
969737548 4:9001348-9001370 CCCCCAGCAGGGGAAGGGGCGGG + Intergenic
969829216 4:9781659-9781681 CGCCACTGAGGGGCTGGGGCAGG - Exonic
971633806 4:29031251-29031273 GGACGAGGAGGGGAAGGGGGAGG - Intergenic
974626543 4:64433316-64433338 GGCTGGGGAGGGGGAGGGGCAGG + Intergenic
977693885 4:99946628-99946650 CGCCGCGGAGGAGGCGAGGCGGG + Exonic
979831913 4:125315098-125315120 CTGTGCGGCGGGGAAGGGGCGGG + Intergenic
980053773 4:128061461-128061483 CGTCGCGGAGAGGACGGGGCCGG + Intronic
980563021 4:134502030-134502052 GGCAGGGGAGGGGAAGGGGGTGG - Intergenic
981323048 4:143414975-143414997 CCCTGCGGAGGGGGAGGGGTGGG - Intronic
981713699 4:147732658-147732680 CGCCGCAGAGCCGCAGGGGCGGG - Intronic
982042389 4:151409099-151409121 GGCCGGGGCGGGGCAGGGGCGGG - Intergenic
982712329 4:158769375-158769397 CGCCGGGGAGGGGACGGGTAGGG + Intronic
983158814 4:164384304-164384326 GGGCGCGGTGGGGATGGGGCCGG + Intergenic
984953150 4:185020985-185021007 CACCGCGGAGGGGACGGGTGTGG - Intergenic
985688650 5:1295074-1295096 GGCCGCGGAAAGGAAGGGGAGGG + Intergenic
986608623 5:9546173-9546195 CGCGGCGGCGGGGGCGGGGCAGG - Intergenic
988595352 5:32585752-32585774 GGACGCCGAGGGGAAGGGGGAGG - Intronic
988734556 5:34007715-34007737 TCCCGCGGAGGGGAGGGGCCTGG - Intronic
989229984 5:39074470-39074492 CGCCGCCGAGGGGGCGGGGGAGG - Intergenic
990008632 5:50969606-50969628 TGCCGGGGAGCGGAAGGGGGAGG + Intergenic
990743698 5:58937230-58937252 AGCAGGGGAGGGGGAGGGGCGGG + Intergenic
992312158 5:75511689-75511711 CGCCGGGAGGGGGACGGGGCGGG - Intronic
992487517 5:77210635-77210657 CGCCGCGGCGGGGAGGGTGGCGG + Intronic
995142294 5:108748461-108748483 GGCCGCGGCCGGGAAGTGGCCGG - Intronic
995518417 5:112976782-112976804 AGACGAGAAGGGGAAGGGGCGGG - Exonic
996404836 5:123094776-123094798 AGCCTCGCAGGGGCAGGGGCCGG + Intronic
998130399 5:139648781-139648803 CGAGGCCGAGGGGGAGGGGCGGG - Exonic
998207175 5:140166159-140166181 GGCTGGGGAGGGGAGGGGGCAGG + Intergenic
999235205 5:150086428-150086450 GGCCTCGGTGGGGAAGTGGCAGG + Exonic
1000014546 5:157266022-157266044 AGCCGCTGCGGCGAAGGGGCGGG + Intergenic
1001056614 5:168455139-168455161 TGCCACGGAGGGGTAGGGGTCGG + Intronic
1002524342 5:179806968-179806990 CGCCGCGGAGTCGACGGCGCAGG + Intronic
1002541157 5:179907513-179907535 GGGCGCGGAGGGGCCGGGGCGGG - Intronic
1003078042 6:2999758-2999780 CGCCGGGGCGGGGAGTGGGCGGG + Intronic
1003277201 6:4662811-4662833 GGCCTCTGAGGGGAAGGGTCTGG - Intergenic
1004689044 6:17976219-17976241 GGGCGCGGTGGAGAAGGGGCCGG + Intronic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006030390 6:31173149-31173171 CTCAGAGGAGGGGGAGGGGCAGG + Intronic
1006136216 6:31897620-31897642 CGCCGAGGTGCGGAAGGGGAGGG - Exonic
1006267753 6:32939283-32939305 CTCCCTGAAGGGGAAGGGGCTGG + Intronic
1006470019 6:34223490-34223512 GGCATGGGAGGGGAAGGGGCGGG + Intergenic
1006535684 6:34696901-34696923 CGTCCGGGAGAGGAAGGGGCGGG - Intergenic
1007775721 6:44223467-44223489 CGCCGCGGGGTGGCAGGGGTGGG + Intronic
1007902047 6:45422032-45422054 CGCCGCGGAGGCGGCGGCGCGGG + Intronic
1010794884 6:80106948-80106970 CGCCCGCGAGGGGCAGGGGCCGG + Intronic
1011685425 6:89819822-89819844 CGCCGCTGAGGGGCTGAGGCCGG - Intergenic
1011734345 6:90296641-90296663 CGCCGGGAAGGGGGAGGGGAAGG + Exonic
1012410131 6:98947649-98947671 GGCCGCGGGCGGGGAGGGGCGGG + Intronic
1013117751 6:107115385-107115407 CCCCGCTGAGGGGGAGGGGCGGG - Intergenic
1013366388 6:109441052-109441074 GGCCGCGGTGGGGACGGGGGCGG - Exonic
1015244569 6:131062690-131062712 CCCCGCGGGGGGGATGGAGCCGG + Intronic
1015935646 6:138404229-138404251 CGCCGCGGAGGGGCGGGGGCAGG + Exonic
1016738770 6:147507801-147507823 CGCCGACGAGGGGGAGGGGCCGG + Intergenic
1017672065 6:156778036-156778058 CGCCGCGGAGGAGGAGGAGGAGG - Exonic
1019162960 6:170081143-170081165 AGCCGGGGAGGGGAAGAGGAGGG + Intergenic
1019198456 6:170295975-170295997 CGCGGCGCAGAGGAGGGGGCGGG - Intronic
1019327525 7:445689-445711 GCCCGCAGTGGGGAAGGGGCAGG - Intergenic
1019472841 7:1230277-1230299 CGCGGGGGAGGGGGAGGGGGCGG + Intergenic
1019926494 7:4196527-4196549 CGGCGTGGAGAGCAAGGGGCAGG - Intronic
1020274312 7:6615536-6615558 CGCGGCGGGCGGGCAGGGGCGGG + Intergenic
1021668616 7:23013493-23013515 CGCCGCGGCAGGGAGGGGACGGG + Intronic
1023812905 7:43926351-43926373 CGCGGCCGAGGGGAAGCAGCGGG - Intronic
1023873774 7:44276170-44276192 CGGGGAGGAGGGAAAGGGGCGGG + Intronic
1024688806 7:51777463-51777485 AGCCTAGGAGGGGCAGGGGCTGG - Intergenic
1025731859 7:64114692-64114714 CCCCGCGTAGGGGTAGTGGCTGG - Intronic
1026253514 7:68691083-68691105 CGAAGGGGAGGGGAAGGGGAGGG + Intergenic
1026360547 7:69598415-69598437 GGCCGCGGAGGGGGAGGAGCGGG + Intergenic
1028796400 7:94908106-94908128 CGCCGCGGGCGGGGAGGGTCGGG - Intronic
1028987667 7:97021113-97021135 CGCCGCCCCGGGGAAGGCGCGGG - Intronic
1029640202 7:101815739-101815761 GCCCGCGGAGGGGAGGGGGAGGG + Intergenic
1030169708 7:106588995-106589017 CGGCGAGGAGGGGAGGGGTCTGG - Intergenic
1030215996 7:107044602-107044624 CACCGCGGCGGGGCGGGGGCGGG + Intergenic
1031604077 7:123748469-123748491 CGCCGACGAGGGGCCGGGGCCGG + Intronic
1032021554 7:128409656-128409678 CGACGCTGCGGGGGAGGGGCAGG - Intronic
1032174345 7:129611683-129611705 CGCCGAGGAGGGGGAGGGGAGGG - Intergenic
1032240007 7:130153257-130153279 GGCTCCGGCGGGGAAGGGGCTGG + Intergenic
1033597779 7:142868956-142868978 CGCTGCTGAGGGGAAGGGGCAGG - Exonic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1034191828 7:149219098-149219120 CTCCAGGGAGGGAAAGGGGCTGG - Intronic
1034833454 7:154330031-154330053 GGCGGTGGAGGGGAAGGGGAGGG + Intronic
1034957746 7:155345016-155345038 CGCGGCGGGGGCGAAGGGGCGGG - Intergenic
1034975909 7:155449246-155449268 TCCCCCGGCGGGGAAGGGGCCGG + Intergenic
1035062470 7:156079718-156079740 CTCAGAAGAGGGGAAGGGGCAGG - Intergenic
1035387333 7:158482921-158482943 TGCCTCCGAGGAGAAGGGGCTGG - Intronic
1036173673 8:6515207-6515229 CTCTGTGGAGGGGCAGGGGCTGG - Intronic
1036210322 8:6835520-6835542 CCGCGTGCAGGGGAAGGGGCGGG - Exonic
1036788657 8:11703850-11703872 CGCAGCGGCGGGCGAGGGGCGGG - Intronic
1036830089 8:12014536-12014558 CCCCTAGCAGGGGAAGGGGCGGG - Intronic
1036899173 8:12658829-12658851 CCCCCAGCAGGGGAAGGGGCGGG - Intergenic
1037482014 8:19313958-19313980 CGCCGCGAAGGGGTGGAGGCGGG - Intronic
1038516052 8:28188472-28188494 CTCCGGGGAGGGAAGGGGGCTGG + Intronic
1038728616 8:30105143-30105165 CACTGAAGAGGGGAAGGGGCTGG + Intronic
1038816751 8:30912335-30912357 CGCGGGGGCGGGGAGGGGGCGGG - Intergenic
1039434288 8:37548994-37549016 CACTGCCAAGGGGAAGGGGCAGG - Intergenic
1039903108 8:41767094-41767116 GGCCGCGGAGGGGCTGGAGCCGG - Intronic
1043388418 8:79768919-79768941 GGCCGCCGGGGGGAGGGGGCGGG - Intergenic
1046094366 8:109539898-109539920 GGGCGGGGAGGGGGAGGGGCAGG + Intronic
1046849048 8:118952200-118952222 GGCCGCTGGCGGGAAGGGGCCGG - Exonic
1048459445 8:134608941-134608963 CGCAGCAGAGGGGATGGTGCTGG + Intronic
1048552328 8:135445048-135445070 CGCCGTGGGGGTGAAGGGGAGGG + Intergenic
1048565160 8:135588495-135588517 CTCCAAGGAGGGGAGGGGGCTGG - Intronic
1049165355 8:141122240-141122262 GGCGGCGGTGGGGAGGGGGCCGG - Intronic
1049194688 8:141308619-141308641 CGGTGCGGAGGGGCCGGGGCCGG - Intergenic
1049353616 8:142177252-142177274 GGCCGGGAATGGGAAGGGGCAGG - Intergenic
1049390560 8:142367512-142367534 CGCCGGGGCGGGGGAGGGGGAGG + Intronic
1049396332 8:142402922-142402944 CGGTGGGGAGGGGAGGGGGCGGG - Intronic
1049418072 8:142504528-142504550 CACAGCGGTGGGGAAGGGTCTGG + Intronic
1049774423 8:144397899-144397921 CTCAGCGGCGGGCAAGGGGCAGG + Intronic
1049803973 8:144530636-144530658 GGGCGCGGAGGGGCGGGGGCGGG + Intronic
1051855514 9:21559921-21559943 CGCCGCGGAAAGGAGGGGGAGGG + Intergenic
1052991777 9:34522907-34522929 CGCGGCCGAGGGGGAGGGCCGGG - Exonic
1054775569 9:69121380-69121402 CGGCGGGGAGGGGAAGGGGGTGG - Intronic
1056934861 9:90908773-90908795 CGCCCCAGAGGGGCAGAGGCAGG - Intergenic
1056992435 9:91424002-91424024 CGCCGCGGAGGGGGAGCTGAGGG - Intergenic
1056992573 9:91424471-91424493 CGCTGCGGCGGGGAAGGGGTTGG + Intergenic
1057234283 9:93346360-93346382 AGCCACGGAGGGGAGGCGGCCGG + Exonic
1057259655 9:93576640-93576662 CGCCGCGGCCGGGAGGGGACGGG - Exonic
1058967090 9:110048612-110048634 CGAGGAGGCGGGGAAGGGGCGGG + Exonic
1059268947 9:113060613-113060635 AGCCGCGGAGGGGTGGGGGATGG - Intergenic
1059270083 9:113066062-113066084 AGCCGCGGAGGGGTGGGGGATGG - Intergenic
1059271217 9:113071510-113071532 AGCCGCGGAGGGGTGGGGGATGG - Intergenic
1059272350 9:113076956-113076978 AGCCGCGGAGGGGTGGGGGATGG - Intergenic
1059273485 9:113082398-113082420 AGCCGCGGAGGGGTGGGGGATGG - Intergenic
1059274621 9:113087844-113087866 AGCCGCGGAGGGGTGGGGGATGG - Intergenic
1060280541 9:122213161-122213183 CGGGGTGGAAGGGAAGGGGCTGG - Intronic
1061250424 9:129423101-129423123 TGCCGAGGAGGGGGTGGGGCGGG + Intergenic
1061964472 9:134005211-134005233 CGGAGGGGAGGGGAGGGGGCAGG - Intergenic
1062277156 9:135736514-135736536 CGCCGCGCAGTGGAACGGCCGGG - Intronic
1062284129 9:135765568-135765590 CGCCCGGGCGGGGCAGGGGCTGG + Intronic
1062362102 9:136193080-136193102 CCCCGCGGAGCGGGAGGTGCGGG - Intergenic
1062540461 9:137039706-137039728 CCCCGGGGAGGGGCAGGGCCTGG - Exonic
1062621263 9:137423472-137423494 TCCCGCGGAGGGGCCGGGGCCGG - Exonic
1185641593 X:1591872-1591894 GGCCTCGGAGGTGACGGGGCTGG + Intronic
1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG + Intergenic
1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG + Intronic
1187950523 X:24465711-24465733 GGGCGCGGAGGGGCAGGGCCTGG + Intronic
1188003473 X:25002511-25002533 CGCGGCCGAGGGGAGGGTGCAGG - Intergenic
1188139020 X:26525665-26525687 CTCGGCGGAGGGGATGTGGCAGG + Intergenic
1188225991 X:27598360-27598382 CCCCCCCGAGGGGATGGGGCGGG + Intronic
1189332878 X:40153926-40153948 CGCCGTGGGGGGCAGGGGGCGGG + Intronic
1189332935 X:40154234-40154256 GGGCGAGGAGGGGGAGGGGCGGG - Intronic
1190266887 X:48831967-48831989 CGCCGCGGCGGGGACGGGCGCGG + Exonic
1190542972 X:51496873-51496895 CGCGGCGGAGGGCGAGGGGCGGG + Intergenic
1196717184 X:118823445-118823467 CGGGGAAGAGGGGAAGGGGCGGG - Intergenic
1198404672 X:136300465-136300487 CGCCGGGGAGGGGCTGCGGCGGG + Intergenic
1199194805 X:145015907-145015929 CGGGGCGGAGGGGAGCGGGCAGG + Intergenic
1200058859 X:153475113-153475135 CCCACCGGAGGGGATGGGGCGGG + Intronic
1200683939 Y:6244155-6244177 TGCAGCTGAGGGGCAGGGGCGGG + Intergenic
1201048696 Y:9910231-9910253 TGCAGCTGAGGGGCAGGGGCGGG - Intergenic
1201291244 Y:12421782-12421804 GGCCGCGGTGGGCGAGGGGCTGG - Intergenic
1201489447 Y:14524780-14524802 CACCGCGGAGTGGAAGGCGCAGG - Intronic