ID: 1148207053

View in Genome Browser
Species Human (GRCh38)
Location 17:45785373-45785395
Sequence TGACGCCTGACACGAGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148207053_1148207062 21 Left 1148207053 17:45785373-45785395 CCCGCCGCTCGTGTCAGGCGTCA 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1148207062 17:45785417-45785439 CAGAGCGTTTTGGTTTTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 109
1148207053_1148207061 20 Left 1148207053 17:45785373-45785395 CCCGCCGCTCGTGTCAGGCGTCA 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1148207061 17:45785416-45785438 CCAGAGCGTTTTGGTTTTGCAGG 0: 1
1: 0
2: 1
3: 6
4: 101
1148207053_1148207059 11 Left 1148207053 17:45785373-45785395 CCCGCCGCTCGTGTCAGGCGTCA 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1148207059 17:45785407-45785429 AAGCGCTTTCCAGAGCGTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 70
1148207053_1148207063 27 Left 1148207053 17:45785373-45785395 CCCGCCGCTCGTGTCAGGCGTCA 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1148207063 17:45785423-45785445 GTTTTGGTTTTGCAGGGTATAGG 0: 1
1: 0
2: 2
3: 29
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148207053 Original CRISPR TGACGCCTGACACGAGCGGC GGG (reversed) Intronic