ID: 1148207719

View in Genome Browser
Species Human (GRCh38)
Location 17:45790024-45790046
Sequence CATCAAAAGGAGAAGTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148207713_1148207719 2 Left 1148207713 17:45789999-45790021 CCAACTTCCTCAGTCTAAGAAAG 0: 1
1: 0
2: 1
3: 18
4: 313
Right 1148207719 17:45790024-45790046 CATCAAAAGGAGAAGTGGTGAGG 0: 1
1: 0
2: 2
3: 22
4: 371
1148207715_1148207719 -5 Left 1148207715 17:45790006-45790028 CCTCAGTCTAAGAAAGGCCATCA 0: 1
1: 0
2: 4
3: 19
4: 204
Right 1148207719 17:45790024-45790046 CATCAAAAGGAGAAGTGGTGAGG 0: 1
1: 0
2: 2
3: 22
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148207719 Original CRISPR CATCAAAAGGAGAAGTGGTG AGG Intronic
903395318 1:22997607-22997629 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
903431442 1:23304239-23304261 CAAGTGAAGGAGAAGTGGTGAGG - Intronic
904657965 1:32063409-32063431 CATCCCAAGGAGAGGGGGTGGGG - Intergenic
905806343 1:40880362-40880384 GAACAAAAGGAGCAGTGGGGTGG + Intergenic
906049671 1:42859760-42859782 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
906081386 1:43091038-43091060 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
909044087 1:70688147-70688169 CTTCAAAATGAGAAGTCGTTGGG - Intergenic
909059613 1:70865257-70865279 TATCAAAAGCAGTAGGGGTGTGG + Intronic
910051449 1:82978819-82978841 CAAAAACAGGAGAAGGGGTGAGG - Intergenic
910777688 1:90892511-90892533 CATCAGAGGGAGACGTGGAGAGG + Intergenic
910872526 1:91847913-91847935 CATAAAAGGAAGAAATGGTGGGG + Intronic
911354074 1:96794771-96794793 CAACAAAAGGAGAAATTGGGAGG + Intronic
911512493 1:98824920-98824942 CATAAAAAGGGGAAGTGGTTTGG - Intergenic
911845330 1:102745646-102745668 CATCAAAAGGAGAAGGAGAGGGG - Intergenic
912021719 1:105114405-105114427 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
912421593 1:109545754-109545776 CATCAAAAGGGGAAATGGGCTGG + Exonic
913039820 1:115011430-115011452 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
914924791 1:151875134-151875156 CATGAAATGGCCAAGTGGTGAGG - Intronic
916824138 1:168428214-168428236 CAGAAAAAGGAAAAGTGGAGAGG + Intergenic
916942301 1:169688600-169688622 CAGCAAAGGGAGATGGGGTGGGG - Intronic
917092947 1:171372262-171372284 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
917493847 1:175522108-175522130 AAAAAAAAGGAGAAGTGGAGTGG - Intronic
917704117 1:177614050-177614072 CATCAAAAGAACAAATGTTGAGG + Intergenic
920142788 1:203831489-203831511 AGTCAAATGGAGTAGTGGTGAGG - Intronic
923074888 1:230601523-230601545 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
923323157 1:232856575-232856597 CTGCAAAAGGAGCAGTGGGGAGG - Intergenic
923568232 1:235092553-235092575 CATTAACAGGAGAAGTGAGGCGG - Intergenic
923681900 1:236125120-236125142 CATCATCAGAAGAAGTGGTCTGG - Intergenic
924752754 1:246910748-246910770 CATCAGAAGCAGAAGTGATTTGG - Intronic
1063051081 10:2448332-2448354 CATCAGAATGAGAAATGGAGAGG - Intergenic
1067360060 10:45571448-45571470 CAGCAAAGGGAGAAAGGGTGGGG - Intronic
1068039397 10:51803918-51803940 GATCAAATGGTGAAGTTGTGGGG + Intronic
1068204078 10:53824970-53824992 CATCAAAAGGAAATTGGGTGTGG + Intronic
1068360524 10:55971776-55971798 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1070001871 10:72384514-72384536 CATCACAAAGAGAAGAGATGGGG - Intronic
1070385493 10:75920275-75920297 CATCAACAGGAAAAGTCCTGGGG - Intronic
1072010805 10:91301449-91301471 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1072011630 10:91307021-91307043 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1073866796 10:107813930-107813952 CATGAAAAGAACAAGTGGGGCGG + Intergenic
1074613224 10:115040645-115040667 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1074638685 10:115352246-115352268 CAACAAAAGGAGAAGTTATTTGG - Intronic
1075388279 10:122073514-122073536 CATTAAAAGAAGAATTGGTAAGG - Intronic
1077657954 11:4040306-4040328 CTTCCAGAGGAGATGTGGTGTGG - Intronic
1077671842 11:4165017-4165039 CATCAAGCTGAGAATTGGTGGGG + Intergenic
1078259671 11:9693829-9693851 CATCAGAAAGAAAAGTGGGGTGG - Intronic
1079271248 11:18987912-18987934 CATGAAAAGGAGAAACGGGGCGG + Intergenic
1079528187 11:21415745-21415767 AAGCAAAAGGAGAAGGGCTGGGG + Intronic
1079581017 11:22065036-22065058 CATCAACAGCAGAATTGATGAGG + Intergenic
1079816673 11:25068834-25068856 CATCAAAGGTAGCAGTTGTGAGG - Intronic
1080076010 11:28150500-28150522 AATTAAAAGGAGAAAAGGTGAGG + Intronic
1080994814 11:37586741-37586763 CAGCAAAAGAAGAGGTGGTGGGG - Intergenic
1081033616 11:38115075-38115097 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1081450537 11:43167221-43167243 CATCAGAAGGAGGACTGGTAGGG + Intergenic
1083353055 11:62044819-62044841 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1083534256 11:63454078-63454100 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1084353705 11:68623078-68623100 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1084355229 11:68634049-68634071 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1084472500 11:69371260-69371282 CAGGAAAAGAAGCAGTGGTGGGG + Intergenic
1084585261 11:70057527-70057549 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1085500955 11:77023313-77023335 TATAATAAGGAGAAGAGGTGTGG + Exonic
1085667566 11:78428499-78428521 AAACATTAGGAGAAGTGGTGGGG + Intergenic
1085901075 11:80700292-80700314 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1086125572 11:83345287-83345309 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1086549926 11:88043679-88043701 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1086834948 11:91609340-91609362 TATCAAAAGTAGCAGTGATGTGG - Intergenic
1086995480 11:93351549-93351571 CATGAAAAAGAAAAATGGTGTGG + Intronic
1088711233 11:112510811-112510833 CATCAAAGGCAGAAGTGGTGTGG + Intergenic
1091555825 12:1572805-1572827 GGTCAAAATGAGAAGTGATGAGG + Intronic
1092416468 12:8293843-8293865 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1092669324 12:10844877-10844899 CATCAAAATCAGATATGGTGTGG + Intronic
1093426580 12:19034946-19034968 CCTCAAAAGGAGAAGGTCTGGGG - Intergenic
1096658641 12:53107256-53107278 CACCAAAAGCAGCAGTGGAGTGG + Intronic
1097124888 12:56766190-56766212 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1097266468 12:57748356-57748378 CCTCAAAAGGAGAGGTGGGAGGG + Exonic
1097962217 12:65543924-65543946 TATCAAAAGGGGAGGTTGTGTGG + Intergenic
1098287493 12:68922085-68922107 GCTCAAGAGGAGAAGAGGTGTGG + Intronic
1098491077 12:71079388-71079410 CTTCAAAAGGTGAAATGTTGAGG - Intronic
1098654163 12:73007418-73007440 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1098956397 12:76694016-76694038 TTTGATAAGGAGAAGTGGTGGGG + Intergenic
1101871647 12:108570726-108570748 AATCACAAAGAAAAGTGGTGGGG - Intergenic
1102856540 12:116299338-116299360 CATAGAAAGGAGAAGTGTGGGGG + Intergenic
1103181691 12:118917856-118917878 CATCACAAGCAGAACTGATGCGG + Intergenic
1103840911 12:123863537-123863559 CACCAGAAGCAGAAGAGGTGAGG - Intronic
1103981797 12:124741650-124741672 CACCAAAAGGCTAAGAGGTGGGG + Intergenic
1105074330 12:133262280-133262302 CATCCAAAGGAGAGATGCTGAGG - Intergenic
1105636560 13:22221053-22221075 AATTAAAAGGAGAACTGGTAGGG + Intergenic
1106400450 13:29424829-29424851 CAGCAAAAGGAGAGGAGGGGTGG + Intronic
1107519566 13:41166238-41166260 TAACAAAAGGAGAACTGGGGTGG - Intergenic
1108153174 13:47557535-47557557 GGTCAAAAGGAGGACTGGTGTGG + Intergenic
1109314381 13:60733072-60733094 AATGAAAAGTAGAAGTTGTGTGG + Intergenic
1109422526 13:62132042-62132064 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1109597727 13:64578647-64578669 CATCAAAAGGAACAGTGAAGTGG + Intergenic
1109923967 13:69109515-69109537 CCTCTAAAGGAGAAGTAGAGAGG - Intergenic
1110295426 13:73858761-73858783 CATGAAAAGGAAAAGTAATGGGG + Intronic
1113119530 13:106911541-106911563 TTACAAAAGGAGAAGTGGAGGGG - Intergenic
1113845986 13:113391918-113391940 CATCAAAGGGGGAAATGGTGAGG + Intergenic
1114197852 14:20494873-20494895 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1114221414 14:20701130-20701152 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1114222180 14:20706455-20706477 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1114346068 14:21796544-21796566 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1115601494 14:34959929-34959951 GAACAAAAGGAGAAGTGATAAGG + Intergenic
1116020848 14:39458475-39458497 AATCAATAGGAAAAGTGGTTTGG - Intergenic
1117393819 14:55289100-55289122 CACCAAAAAGAGAAGTTTTGGGG - Intronic
1118121680 14:62852318-62852340 CATGAAAATGAGAAGCAGTGAGG - Intronic
1118461828 14:65994394-65994416 CATCAAATGAAGGAGTGATGAGG + Intronic
1118930900 14:70239477-70239499 CACCAAAAGGAGAAGAAGTGTGG + Intergenic
1118989917 14:70788622-70788644 GCTCTAAAGGAGAAGAGGTGTGG + Intronic
1119775187 14:77243908-77243930 AATCAGCAGCAGAAGTGGTGTGG - Intronic
1120440483 14:84531036-84531058 CATAAAAAATATAAGTGGTGGGG + Intergenic
1121119022 14:91364293-91364315 AACCTAAAGGAGAAGTGGGGAGG - Intronic
1123504482 15:20926272-20926294 GATCAAGAGGAGAAGTTATGAGG + Intergenic
1123561728 15:21499973-21499995 GATCAAGAGGAGAAGTTATGAGG + Intergenic
1123597972 15:21937254-21937276 GATCAAGAGGAGAAGTTATGAGG + Intergenic
1123882760 15:24690727-24690749 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1124139368 15:27063892-27063914 AGGCAAAAGGAGAAGGGGTGTGG - Intronic
1124397489 15:29316589-29316611 CATCCAAGGGAGAAGTGGTGGGG + Intronic
1125825054 15:42669232-42669254 CATCAACAGGAGGAGGGCTGGGG + Exonic
1126525536 15:49650195-49650217 CATCATAGGGAGTAATGGTGTGG + Exonic
1127203843 15:56690792-56690814 CATTAAAAGTAGAAATGGTACGG + Intronic
1127581821 15:60345743-60345765 CTGCAAAGGGAGCAGTGGTGTGG - Intergenic
1130297164 15:82655589-82655611 CATCAAAAGGATGGGTGTTGAGG - Intergenic
1131552800 15:93372541-93372563 CGTCAAAAGAAGAGGTGTTGGGG + Intergenic
1202970073 15_KI270727v1_random:227098-227120 GATCAAGAGGAGAAGTTATGAGG + Intergenic
1135339216 16:21632075-21632097 CATCAAAAGGGGAAGGAGAGGGG - Intronic
1137728372 16:50672202-50672224 CCTCAAAAGGGGCAGTGTTGAGG + Exonic
1137805181 16:51297864-51297886 CATCAGAATGAGGAGTGGGGTGG + Intergenic
1140076919 16:71708451-71708473 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1140144289 16:72290366-72290388 CACCTAAAGGACAAGAGGTGGGG - Intergenic
1140972324 16:80025249-80025271 GATCAACAGGAGAAGAGATGGGG + Intergenic
1143124923 17:4635924-4635946 CAAGAAAAGGGGAGGTGGTGGGG + Exonic
1143259697 17:5588833-5588855 CTTCAAATGGAGCAGGGGTGGGG + Intronic
1143403589 17:6661226-6661248 CAGGAAAAGGGGAGGTGGTGGGG - Intergenic
1143623412 17:8094272-8094294 GAGCAAAGGGAGAAGTGGTTTGG + Intergenic
1144953527 17:19006083-19006105 CATCAACTGCAGAAGTGTTGGGG - Intronic
1145304549 17:21666192-21666214 TATCAAATGGAGATGTGCTGGGG - Intergenic
1146665571 17:34700528-34700550 CTTCCACAGGAGAAGTAGTGTGG + Intergenic
1146711016 17:35041500-35041522 CATGAATTGGAGAAGTGGTCAGG - Intronic
1147381830 17:40060888-40060910 CATCAAAGAGAGATATGGTGGGG + Intronic
1147808340 17:43148401-43148423 CAGCAAAAGGAGATGGGGTGGGG + Intergenic
1148207719 17:45790024-45790046 CATCAAAAGGAGAAGTGGTGAGG + Intronic
1149320496 17:55476396-55476418 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1150921266 17:69486111-69486133 CATGTGAAGGAGAAGTGGGGTGG + Intronic
1203192201 17_KI270729v1_random:200005-200027 CAGCAAAAGCCGAAGTGGCGGGG - Intergenic
1153293718 18:3525858-3525880 CATGAAGAGGTGAAGTGATGTGG - Intronic
1153438237 18:5089036-5089058 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1155284973 18:24278896-24278918 CACCAAAAATAGAAGTGCTGAGG + Intronic
1155690876 18:28621017-28621039 CAACAAAAGAAGAAGTTGTGTGG + Intergenic
1155784269 18:29877510-29877532 CTTCAAATGGAGCAGGGGTGGGG - Intergenic
1155812842 18:30260127-30260149 CATCTAAAGAAAAAGAGGTGAGG + Intergenic
1155838138 18:30613002-30613024 CAGCGAAAGGAGATGGGGTGGGG - Intergenic
1156864583 18:41874614-41874636 CATCATAAGGTGGAGTGGTGGGG - Intergenic
1156939191 18:42744179-42744201 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1157596786 18:48869061-48869083 GAGGAAAAGGAGAAGTGCTGAGG + Intergenic
1157666977 18:49495502-49495524 CAACAAAAGGAGCAAGGGTGGGG - Intergenic
1157996879 18:52568699-52568721 CATCTAAATGAGAAGTGTGGGGG - Intronic
1158072310 18:53487172-53487194 CAATACAAGGGGAAGTGGTGGGG + Intronic
1158265904 18:55660483-55660505 AACCAAAATGAGAATTGGTGAGG + Intronic
1159164964 18:64687200-64687222 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1160357408 18:78239618-78239640 AATCAAAAGGAGCGCTGGTGTGG + Intergenic
1161827355 19:6577174-6577196 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1163033429 19:14558822-14558844 CATCTCCAGGAGAAGCGGTGAGG - Intronic
1163812087 19:19439550-19439572 TAGCAAAAGGACAAGTGGTCAGG + Intronic
1167389261 19:49183051-49183073 CAGCAAAAGGAGGGGTGGTGAGG - Intronic
1167901698 19:52627190-52627212 CAGCAAAAGGAGATGGGGTGGGG - Intronic
925687199 2:6484301-6484323 CTTCAAATGGAGCAGAGGTGGGG + Intergenic
926851184 2:17199154-17199176 CATCAAGAGGAAAATTGGTCTGG + Intergenic
927356151 2:22175837-22175859 AAAGAAAAGGAGATGTGGTGAGG - Intergenic
927413705 2:22855140-22855162 TTTCCAAAGGAGATGTGGTGGGG + Intergenic
928286599 2:29995450-29995472 CATGCAAAGGAGAAGAGATGGGG + Intergenic
928958452 2:36896506-36896528 CATCGAAGGTAGAAGTGGAGTGG - Intronic
929004347 2:37381116-37381138 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
930068415 2:47345449-47345471 GATCCAAAGGAGAAGTGGGAGGG - Intronic
930954670 2:57192608-57192630 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
930954784 2:57193371-57193393 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
931307574 2:61045730-61045752 CATCAACTGGGCAAGTGGTGAGG + Exonic
933217649 2:79648730-79648752 GAACAAAAGGAGTGGTGGTGGGG - Intronic
933300569 2:80536225-80536247 CATCACAATGAAAAGTGCTGCGG - Intronic
933439940 2:82299095-82299117 CTTCAAAAGGAGATATGGAGAGG + Intergenic
933892186 2:86782091-86782113 CATCAACAGCAGAAGTGGGGTGG + Intergenic
936323341 2:111484934-111484956 AAAAAAAAGAAGAAGTGGTGAGG + Intergenic
936613354 2:114023620-114023642 CATTAAAAAGAGGAGTGATGGGG - Intergenic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
938763731 2:134446683-134446705 CATCAAGAGCAGGGGTGGTGGGG + Intronic
938805760 2:134806035-134806057 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
939461003 2:142495039-142495061 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
939788006 2:146540170-146540192 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
940033584 2:149289991-149290013 CAGCAAAAGGAAGAGAGGTGTGG - Intergenic
940262879 2:151801371-151801393 CATAAAAAGGACAAAAGGTGTGG + Exonic
940508203 2:154582740-154582762 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
941243701 2:163071193-163071215 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
941918543 2:170828045-170828067 CAGCAGAAGGAGGAGGGGTGAGG - Intronic
941918552 2:170828083-170828105 CAGCAGAAGGAGGAGGGGTGAGG - Intronic
942710490 2:178829476-178829498 CATCAAAAGGAACAGTGCTGTGG + Intronic
943902192 2:193454732-193454754 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
943945713 2:194060568-194060590 CATTAAATGCAGAGGTGGTGAGG + Intergenic
946988029 2:225295947-225295969 CATCAAATGGAGATGCTGTGTGG - Intergenic
947216880 2:227757949-227757971 CAGAAAAAGGAGCAGTGATGAGG - Intergenic
948781834 2:240326245-240326267 CATCAAAAAGGGAAGATGTGAGG - Intergenic
1168839661 20:901475-901497 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1168916122 20:1489795-1489817 TATTAAATAGAGAAGTGGTGAGG + Intronic
1170504241 20:17008374-17008396 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1170875490 20:20246303-20246325 TTGGAAAAGGAGAAGTGGTGGGG + Intronic
1171261785 20:23740342-23740364 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1171270923 20:23816217-23816239 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1172628694 20:36363897-36363919 CATCAGCATGAGCAGTGGTGAGG + Intronic
1174522346 20:51141471-51141493 CATTAAGAGGAGATGTGGTGAGG - Intergenic
1177772899 21:25536762-25536784 AATCAAAAGGTGAAGAGGGGAGG + Intergenic
1177903280 21:26943880-26943902 AATCAAAATGATACGTGGTGAGG - Intronic
1178109575 21:29356943-29356965 CATCAAAAGGGGAAGGAGAGGGG - Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1182961004 22:34475194-34475216 TAGCAAAATGAGAAATGGTGTGG + Intergenic
1183535049 22:38396640-38396662 CAGCAAAGGGAGATGGGGTGGGG + Intronic
1183576941 22:38697204-38697226 AAGCAAAGGGAGAAGAGGTGAGG - Intronic
1185406922 22:50657592-50657614 CATCAAAAATAGCAGTGGTTCGG - Intergenic
949592471 3:5508821-5508843 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
950310959 3:11957292-11957314 CATCCAAGATAGAAGTGGTGAGG - Intergenic
950401962 3:12775789-12775811 CAACAAAGGGCGAAGTAGTGAGG + Intergenic
950708055 3:14795872-14795894 CATGAAGATGAGAAGTGGGGTGG - Intergenic
951239766 3:20274111-20274133 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
952624552 3:35388640-35388662 AATAAAAAGGAAAAATGGTGGGG + Intergenic
953498332 3:43408013-43408035 CAGCAAAAGGAAAACTGGAGTGG + Intronic
953718358 3:45334652-45334674 CTTACAAAGAAGAAGTGGTGAGG - Intergenic
954599221 3:51854603-51854625 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
955396618 3:58562295-58562317 CAGCAAAGGGAGATGGGGTGAGG - Intergenic
956016942 3:64893791-64893813 CTTCACCAGGTGAAGTGGTGGGG + Intergenic
956596417 3:70972216-70972238 CAACAAAAGGAGACGGGGTTGGG + Intronic
957255281 3:77827923-77827945 CAGCAAAAGGAAAAGGTGTGTGG + Intergenic
957288813 3:78250435-78250457 TATCAAAAGGAATGGTGGTGGGG + Intergenic
957893269 3:86387164-86387186 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
958896706 3:99837666-99837688 GGTCAGAAGGAGAAGTGTTGGGG - Intronic
959677340 3:109051220-109051242 CAGCAAAAAGAGAAATGGAGAGG - Intronic
960134653 3:114093009-114093031 AATCAAAAGGAGAGGAGGTGAGG + Intergenic
961109904 3:124275143-124275165 TTTCAACAGGAGAAGTGGGGTGG + Intronic
962660347 3:137595925-137595947 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
962723231 3:138195836-138195858 CAACAAAATGACAAGTGGTGGGG - Intronic
962962396 3:140322516-140322538 CATCCCAAGGATAAGTGGTCAGG + Intronic
963021550 3:140876787-140876809 CATCAAAAGGAGAAGGAGAGGGG + Intergenic
963071877 3:141311476-141311498 CATCCAAGGGGGAAGGGGTGTGG - Intergenic
964984121 3:162718136-162718158 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
965139625 3:164816866-164816888 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967495912 3:190144886-190144908 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
968993074 4:3927732-3927754 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
969695191 4:8730257-8730279 CATGAGAAGGAGCAGGGGTGGGG + Intergenic
970331418 4:14988644-14988666 TATCCAAAAGAGAAGTGGAGTGG + Intergenic
970354027 4:15234618-15234640 CATCTAGAGCAGAAGTGGTTGGG - Intergenic
970524652 4:16919019-16919041 CAGCAAAGGGAGATGAGGTGGGG - Intergenic
970853525 4:20629870-20629892 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
971878019 4:32329152-32329174 CATCAAAAGGAAAAGGTGTATGG + Intergenic
972243382 4:37218564-37218586 CAACATAAGGAGATGTTGTGAGG - Intergenic
974468041 4:62282871-62282893 TATCAGAAGGACAAGTGTTGAGG + Intergenic
974849067 4:67384095-67384117 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
975408793 4:74023552-74023574 CATCAAAAGAAGAAGAGATCTGG - Intergenic
976087494 4:81421122-81421144 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
976102659 4:81581634-81581656 AATCAAAACATGAAGTGGTGAGG - Intronic
976174138 4:82335451-82335473 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
976271579 4:83235713-83235735 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
977041674 4:92026117-92026139 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
977711187 4:100127664-100127686 CATCAACATAAGAACTGGTGGGG - Intergenic
978995748 4:115149949-115149971 TATCAGAAAGAGAAGAGGTGGGG - Intergenic
979280315 4:118860240-118860262 CAACAAAAAGTGAAGTGGCGGGG - Intronic
980593130 4:134917333-134917355 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
980829521 4:138113026-138113048 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
982318532 4:154056830-154056852 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
982490326 4:156021724-156021746 CAGCCAAAGGAGATGGGGTGAGG - Intergenic
983045941 4:162986225-162986247 GCTCAAAAAGTGAAGTGGTGGGG - Intergenic
983266853 4:165516281-165516303 CATCAAAAGCACAGGTGATGAGG + Intergenic
984748950 4:183253201-183253223 CAGCAAAGAGAGCAGTGGTGTGG - Intronic
985871128 5:2557515-2557537 CTTCATATGGAGAAGCGGTGTGG + Intergenic
986132864 5:4946954-4946976 CTTGGAAAGGAGAAATGGTGGGG - Intergenic
986932880 5:12849621-12849643 AATCAAATGGAGAAGAGTTGAGG - Intergenic
987289685 5:16496670-16496692 TATCAAAAAGAGAATTGTTGTGG - Intronic
987930996 5:24398960-24398982 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
989615407 5:43333093-43333115 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
992257097 5:74932079-74932101 CATCAAATGGAAATGGGGTGGGG - Intergenic
993408138 5:87538031-87538053 CATCAAAAGGTGCAGTGCTTGGG + Intergenic
994171015 5:96660191-96660213 GAACAGAAGGAGAAGGGGTGGGG - Intronic
994324561 5:98434829-98434851 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
995349887 5:111163077-111163099 GATAAAAAGGAGCTGTGGTGTGG + Intergenic
995414070 5:111889791-111889813 CAGCAAAGGGAGATGGGGTGGGG + Intronic
995471100 5:112503083-112503105 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
995583004 5:113620427-113620449 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
995911469 5:117192939-117192961 CATCAATAGGAAAACTGGTGAGG - Intergenic
996918249 5:128735875-128735897 CAACAAAGGGAGATGGGGTGGGG - Intronic
996970581 5:129362133-129362155 CCTCAAAAGGAAAAGTGGAAAGG - Intergenic
997497848 5:134345565-134345587 CAGCAAAGGGAGATGGGGTGGGG + Intronic
998355337 5:141530630-141530652 GAACAAATGGGGAAGTGGTGGGG - Intronic
998561009 5:143171496-143171518 CATCACAAGGAGGAGAGGGGAGG + Intronic
998611965 5:143699195-143699217 CCCCAAAAGGAAAAATGGTGAGG - Intergenic
998651769 5:144128564-144128586 CATCACTAGGAGAAGGAGTGAGG + Intergenic
998915350 5:147005585-147005607 CATCAAAAGGGGAAGGAGAGGGG + Intronic
1000263123 5:159608818-159608840 CTCCAAAAGGAGTTGTGGTGGGG + Intergenic
1000367086 5:160501748-160501770 CATCAAAAGGTGAAGTAGACAGG + Intergenic
1000884953 5:166740154-166740176 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1001365986 5:171140548-171140570 CATCAAAAGGACTTGGGGTGAGG - Intronic
1003892495 6:10575931-10575953 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1005284643 6:24312200-24312222 CAGCAAAGGGAGATGGGGTGAGG - Intronic
1005701076 6:28400667-28400689 CATGAAAAAGAAAAATGGTGAGG + Intergenic
1005785853 6:29245578-29245600 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1006979398 6:38134784-38134806 CAGCAAAATGTGAAGTGGTGAGG - Intronic
1007232000 6:40354775-40354797 CAACAACATGGGAAGTGGTGAGG - Intergenic
1007475302 6:42115745-42115767 AATCAAAAGAAAAAGTGTTGGGG + Intronic
1007679800 6:43626189-43626211 CAGGTAAAGGAGAACTGGTGGGG + Intronic
1010487092 6:76427792-76427814 CAACACAAGGAGAAGAGGTTGGG + Intergenic
1010984275 6:82404194-82404216 CCTCCCAAGGACAAGTGGTGGGG + Intergenic
1012685313 6:102240368-102240390 CATCAAGGGAAGCAGTGGTGGGG + Intergenic
1014405281 6:121043460-121043482 CATCACAAGGAGGATTGGTAGGG - Intergenic
1015112337 6:129607478-129607500 AAGCACAAGGAGAAGTGGTAGGG - Intronic
1016166169 6:140946192-140946214 AATCTAAAGGAGGAGTGTTGTGG + Intergenic
1016937375 6:149457197-149457219 CCTCAAAAGGACAAGGGCTGTGG - Intronic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017894471 6:158667384-158667406 CATTAACAGGAGAAGTCGGGAGG + Intronic
1018174356 6:161166176-161166198 GAGCAAAAAGACAAGTGGTGGGG + Intronic
1018495803 6:164344470-164344492 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1019798418 7:3069639-3069661 CATAAAAATGAGGAGTGCTGAGG - Intergenic
1020563690 7:9768767-9768789 CAGGAAAAGAAGAAATGGTGGGG + Intergenic
1021142673 7:17046858-17046880 CAGCAAAAGGAGAACTCTTGCGG + Intergenic
1021472771 7:21024551-21024573 CATCAAAGGGAGAGGCAGTGTGG + Intergenic
1021869842 7:24993691-24993713 CATCACATGGAGATATGGTGAGG + Intergenic
1022708787 7:32832894-32832916 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1024973017 7:55087858-55087880 CTCCAAAAGGAGAAGAGGAGAGG - Intronic
1024973061 7:55088166-55088188 CATGGAAAGGAGCAGTGGTCTGG + Intronic
1025302164 7:57826604-57826626 TATCAAAAGGAGATGTGCTCGGG + Intergenic
1025798307 7:64760416-64760438 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1029642378 7:101829225-101829247 CAGCAAAAGGAGTAGTGGAGAGG + Intronic
1030462040 7:109850968-109850990 CATGAAAAGGATTAGTGGAGGGG + Intergenic
1031615344 7:123872996-123873018 CATCAAAAGGAGAGCTGTTAGGG + Intronic
1031776995 7:125917844-125917866 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1031988260 7:128177933-128177955 GAAGAAAAGGAGAAGTGGGGAGG + Intergenic
1033896694 7:146080029-146080051 AATCAAAAGGAAAAGTGAAGAGG + Intergenic
1033907788 7:146226793-146226815 AATCTAAAAGAGAAATGGTGAGG + Intronic
1034017352 7:147601300-147601322 CAGCAAAGGGAGATGGGGTGGGG + Intronic
1034084249 7:148309517-148309539 CAGCAAAGGGAGATGGGGTGGGG + Intronic
1035496655 7:159333525-159333547 CATCCAAAGGAGAGATGCTGAGG - Intergenic
1037189131 8:16100489-16100511 CTTCAAATGGAGCAGGGGTGGGG - Intergenic
1037210248 8:16377296-16377318 CATAAAAAGCAGAAGAGGAGAGG - Intronic
1038158206 8:25011118-25011140 CCTCAAAAGAAAAAGGGGTGGGG + Intergenic
1038639202 8:29310356-29310378 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1039669460 8:39580326-39580348 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1040999709 8:53438625-53438647 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1042172788 8:66008664-66008686 CCTTATAAGGAGAAGTGGTTTGG + Intergenic
1042319553 8:67460972-67460994 CACCAAATGGAAAAGGGGTGGGG - Intronic
1043519031 8:81024893-81024915 CATCAAATGAAAAATTGGTGAGG - Intronic
1043596910 8:81898119-81898141 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1043717377 8:83504804-83504826 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1044512039 8:93093117-93093139 TATCAAAATGTGAAGTGATGAGG - Intergenic
1045389485 8:101701287-101701309 CATTAAATGTAGAAGGGGTGGGG - Intronic
1046257297 8:111718307-111718329 TAGCAAAAGTAGAAGTGATGAGG + Intergenic
1046550544 8:115710248-115710270 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1048240842 8:132740376-132740398 CAAGAAAAGGGGAAGTGATGGGG - Intronic
1049533744 8:143168600-143168622 CATCTAAGGAAGAAGTGGAGAGG + Intergenic
1050009989 9:1175634-1175656 CAACATAAGGAGAAAAGGTGAGG - Intergenic
1051444286 9:17124096-17124118 CAGCAAGAGGAGAAGAGGTCTGG + Intergenic
1051707671 9:19897926-19897948 CAGCAAAAGGAAAAGTGGGATGG - Intergenic
1053221056 9:36313584-36313606 CATGAACAGGACAAGTGGAGTGG + Intergenic
1054807776 9:69410007-69410029 CAGCGAAAGGAGATGGGGTGGGG + Intergenic
1055401796 9:75932105-75932127 CATTAAAAGGAGATTTGGAGAGG + Intronic
1056132386 9:83599346-83599368 CTTCAAATGGAGCAGGGGTGGGG - Intergenic
1056363174 9:85879331-85879353 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1056391614 9:86146391-86146413 CAGCAAAAGGAGATGGGGTGGGG - Intergenic
1056825819 9:89875706-89875728 CATCAAAAGCAGGTGTGATGGGG - Intergenic
1057521841 9:95766439-95766461 GAACAAAAGGAAAGGTGGTGAGG + Intergenic
1057724604 9:97559323-97559345 CATCACTAAGAGAACTGGTGGGG - Intronic
1057919406 9:99084575-99084597 CTTAAAAAGGAGAAATGGTCCGG + Intergenic
1058448949 9:105078495-105078517 TATTATAAGGAGTAGTGGTGGGG - Intergenic
1059699883 9:116764965-116764987 AGACAAAAGCAGAAGTGGTGGGG - Intronic
1060058013 9:120432584-120432606 CAAGAAAAGGAGCTGTGGTGAGG + Intronic
1060919937 9:127413539-127413561 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1061599629 9:131659149-131659171 CATAAAAAGGACAAATGGAGTGG + Intronic
1185960207 X:4540577-4540599 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1186258760 X:7752587-7752609 TATAAAAAAGAGCAGTGGTGAGG + Intergenic
1186856397 X:13630121-13630143 GGTTAAAAGGAGAAGTGGTGAGG - Intronic
1187204997 X:17173664-17173686 TATCAAAAGCAGAAATAGTGTGG - Intergenic
1187499080 X:19823676-19823698 CATCACATGTAGAAGTTGTGGGG + Intronic
1190922476 X:54868615-54868637 CATCAAAAATATAAGTTGTGAGG - Intergenic
1193584828 X:83308028-83308050 GATAAAAAGGAGAAGTTGTCTGG + Intergenic
1194200979 X:90952516-90952538 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1194383523 X:93224141-93224163 CATCAAAGTGACAAGTGGAGGGG + Intergenic
1196126967 X:112111412-112111434 CATCAAAAGGGGAAGGAGAGAGG - Intergenic
1196222017 X:113122503-113122525 CAGCAAAGGGAGATGCGGTGGGG + Intergenic
1196945887 X:120825744-120825766 AATCAAAATTAGAAGTGGAGTGG + Intergenic
1199765402 X:150937593-150937615 AAGCAGAAGGAGAAGTGATGTGG - Intergenic
1199854511 X:151749732-151749754 CACCAAAAGAAGAAGGAGTGTGG - Intergenic
1200269843 X:154672111-154672133 CATCAAAAGGGCAAGTGTTTGGG - Intergenic
1201174090 Y:11297159-11297181 AATGAAAAGGAGGAGTGGAGTGG - Intergenic
1201271802 Y:12263118-12263140 CATCAAAAGGGGAAGGAGTGGGG - Intergenic
1202089732 Y:21177432-21177454 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1202192247 Y:22257539-22257561 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1202247425 Y:22834108-22834130 CATCACAAGGCGAATGGGTGGGG + Intergenic
1202258273 Y:22942697-22942719 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1202400413 Y:24467856-24467878 CATCACAAGGCGAATGGGTGGGG + Intergenic
1202411263 Y:24576455-24576477 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1202459518 Y:25093617-25093639 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1202470367 Y:25202230-25202252 CATCACAAGGCGAATGGGTGGGG - Intergenic