ID: 1148210642

View in Genome Browser
Species Human (GRCh38)
Location 17:45806539-45806561
Sequence CTGGAGGAAGGGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4798
Summary {0: 1, 1: 2, 2: 28, 3: 401, 4: 4366}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148210632_1148210642 10 Left 1148210632 17:45806506-45806528 CCAGGAAACTGTTCACAAAACAA 0: 1
1: 0
2: 4
3: 14
4: 249
Right 1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG 0: 1
1: 2
2: 28
3: 401
4: 4366
1148210631_1148210642 11 Left 1148210631 17:45806505-45806527 CCCAGGAAACTGTTCACAAAACA 0: 1
1: 0
2: 1
3: 19
4: 283
Right 1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG 0: 1
1: 2
2: 28
3: 401
4: 4366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148210642 Original CRISPR CTGGAGGAAGGGAGGGAAGT GGG Intronic
Too many off-targets to display for this crispr