ID: 1148211140

View in Genome Browser
Species Human (GRCh38)
Location 17:45809385-45809407
Sequence TAACCTGGCCCCAGAGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148211140_1148211145 7 Left 1148211140 17:45809385-45809407 CCCCATGCTCTGGGGCCAGGTTA 0: 1
1: 0
2: 1
3: 24
4: 257
Right 1148211145 17:45809415-45809437 TCAACTTGTTCGTTATGCTCAGG 0: 1
1: 0
2: 1
3: 5
4: 66
1148211140_1148211146 10 Left 1148211140 17:45809385-45809407 CCCCATGCTCTGGGGCCAGGTTA 0: 1
1: 0
2: 1
3: 24
4: 257
Right 1148211146 17:45809418-45809440 ACTTGTTCGTTATGCTCAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148211140 Original CRISPR TAACCTGGCCCCAGAGCATG GGG (reversed) Intronic
900587290 1:3439502-3439524 GAACCGGGCCACACAGCATGGGG - Intergenic
901226740 1:7617510-7617532 TATGCTGGCCCTAGAGCCTGAGG - Intronic
902592714 1:17486426-17486448 GAACCTGGCCGCACAGCAGGAGG + Intergenic
902718232 1:18287547-18287569 TTGCCTGGCCCCAGAGCGAGAGG - Intronic
902938250 1:19780376-19780398 GAACCTGGCCGCACAGCAGGAGG - Intronic
903548498 1:24141910-24141932 TAGGCTGACTCCAGAGCATGTGG - Intronic
903703830 1:25270344-25270366 GAACCTGACCGCACAGCATGAGG + Intronic
903723413 1:25422980-25423002 GAACCTGACCGCACAGCATGAGG - Intronic
905091842 1:35436314-35436336 TGCCCAAGCCCCAGAGCATGTGG - Intronic
905099507 1:35506811-35506833 CAACCTAGCCCCAGAAGATGTGG + Exonic
905335166 1:37240037-37240059 GAAGGAGGCCCCAGAGCATGAGG + Intergenic
906256727 1:44356022-44356044 GAAGCTGGGCCCAGAGGATGGGG - Intergenic
906346097 1:45015423-45015445 TGACATGGACCCAGAACATGTGG + Exonic
906383503 1:45347687-45347709 TAATCTCACCCCACAGCATGGGG - Exonic
906639052 1:47430545-47430567 GAACCTGGCCACACAGCAGGAGG + Intergenic
907650332 1:56288735-56288757 TAACTGGGTCCCAGAGGATGTGG + Intergenic
912456808 1:109803534-109803556 GAACCTGGACCAAGAGCATCAGG - Intergenic
912726531 1:112063748-112063770 GAACCTGGCCACACAGCAGGAGG - Intergenic
914455874 1:147835799-147835821 AAACCTGTCCCCAGAGTCTGAGG + Intergenic
915328225 1:155092246-155092268 TGACCTGGCCCCAGCACATCTGG - Intergenic
917614908 1:176732899-176732921 GAACCTGGCCACACAGCAGGAGG + Intronic
920111383 1:203589734-203589756 TAGCCTGGGCCCAGAGCTTGGGG + Intergenic
920304527 1:205010069-205010091 TAACCGTGTCCCAGAGAATGGGG + Intronic
920429705 1:205910006-205910028 TCACCTGGCCCCAGAGGTTGAGG + Intergenic
920655077 1:207868785-207868807 GGCCCTGGCCCCAGAGCCTGGGG + Intergenic
921937253 1:220806701-220806723 TCACCTCACCCCTGAGCATGAGG + Intronic
922329354 1:224560443-224560465 GAACCGGGCCCCACAGCAGGAGG + Intronic
922765508 1:228154527-228154549 TAACCTGGCTTCAGAGGGTGTGG - Intronic
923349519 1:233089940-233089962 TGGCCTGGCCCCACAGCAGGGGG + Intronic
924907279 1:248469596-248469618 TAATCTGGGCCCAGAGCCAGTGG - Intergenic
924916832 1:248578517-248578539 TAATCTGGGCCCAGAGCCAGTGG + Intergenic
1064339765 10:14475313-14475335 GAACCTGGCCGCACAGCAGGAGG + Intergenic
1067093971 10:43286258-43286280 CAAACCAGCCCCAGAGCATGGGG - Intergenic
1067700017 10:48564655-48564677 TGGCCTGGCCCCAGCACATGAGG - Intronic
1068267475 10:54671884-54671906 GAACCAGGCCACAGAGCAGGAGG + Intronic
1069819111 10:71216841-71216863 TAACCTGGTCCGAGAGCACTTGG - Intronic
1071136204 10:82457478-82457500 GAACCAGGCCACAGAGCAGGAGG - Intronic
1072036739 10:91569805-91569827 TAACCAAGGCCCAGAGCAGGAGG + Intergenic
1074698200 10:116069842-116069864 TGACCTGTCCCCAGAGCTTGGGG - Intronic
1074894225 10:117761031-117761053 ATAACTGGCCCCAGATCATGTGG - Intergenic
1075424372 10:122329951-122329973 TCCCCTGTGCCCAGAGCATGAGG - Intronic
1076565363 10:131394847-131394869 TGGCCTGGCCCTAGACCATGAGG - Intergenic
1077718585 11:4605123-4605145 CAGCCAGTCCCCAGAGCATGAGG - Exonic
1079883102 11:25951333-25951355 GAACCTGGCCTCACAGCACGAGG + Intergenic
1083210837 11:61184636-61184658 TAACCTGTGCCCACAGCATGAGG + Intergenic
1084521050 11:69663059-69663081 GAACCGGGCCCCACAGCAGGAGG + Intronic
1085306221 11:75487484-75487506 TAACATTTCCCCAGAGAATGAGG - Intronic
1085576135 11:77605448-77605470 TAACCAGGCCGCACAGCAGGAGG + Intronic
1086486043 11:87303135-87303157 GAACCTGGCCACACAGCAGGAGG + Intronic
1086993101 11:93327822-93327844 GAACCTGGCCACACAGCAGGAGG - Intergenic
1087812489 11:102623309-102623331 GAACCTGGCCCCACAGCAGGAGG + Intronic
1089319565 11:117615766-117615788 TAACCTGGCCCCATCACATGTGG - Intronic
1089890280 11:121873919-121873941 TATCTTGGTGCCAGAGCATGTGG + Intergenic
1090157961 11:124461358-124461380 TTCCCTGGCCCAAGAGAATGTGG + Intergenic
1090803228 11:130187608-130187630 TCACCTGGCCCAGGAGCCTGTGG - Intronic
1091479734 12:815125-815147 GAACCTGGCCACACAGCAGGAGG - Intronic
1091574490 12:1720703-1720725 GAACCTGGCCTCACAGCAGGAGG - Intronic
1092105816 12:5921149-5921171 TCACCTGGGCCCCCAGCATGAGG + Exonic
1092995346 12:13944466-13944488 GAACCTGGCTACAGAGCAAGAGG - Intronic
1094655955 12:32419604-32419626 TAAGCTGGGCCCAGAGCCAGTGG - Intronic
1095085469 12:38054314-38054336 AAAACTGGCCCCAGAACAGGAGG - Intergenic
1096975422 12:55697015-55697037 GAACCTGGCCCCGGAGCCTCCGG + Exonic
1100382507 12:94074789-94074811 TAACCTGGCCCCACAGTCAGAGG + Intergenic
1101439465 12:104692641-104692663 GAACCAGGCCCCACAGCAAGAGG + Intronic
1102533015 12:113560709-113560731 GAAAATGGCCCCAGAGGATGGGG + Intergenic
1102827586 12:115962438-115962460 GAACCAGGCCCCACAGCATGCGG - Intronic
1103606085 12:122087126-122087148 TGGCCGGGCCCCAGAGCATGAGG + Intronic
1105859185 13:24394683-24394705 AATCGTGGTCCCAGAGCATGTGG + Intergenic
1106525747 13:30539831-30539853 TAACTTGATCCCAGAGTATGTGG + Intronic
1111989815 13:95105314-95105336 GAACCTGGCCACACAGCAGGAGG - Intronic
1114879110 14:26761743-26761765 GAACCAGGCCGCAGAGCAGGAGG + Intergenic
1116070251 14:40034914-40034936 TCACCTGGCTCCAGAACCTGAGG + Intergenic
1116419213 14:44713632-44713654 GAACCTGGCCGCACAGCAGGAGG - Intergenic
1117322195 14:54634631-54634653 GAACCAGGCCACACAGCATGAGG - Intronic
1117696517 14:58370243-58370265 GAAACTGACCCCAGAGCAAGTGG - Intronic
1117851485 14:59975895-59975917 GAACCTGGCCACACAGCAGGAGG + Intronic
1118261097 14:64247402-64247424 TCAGCTGGCCCCAGATCAAGAGG + Intronic
1118363763 14:65076998-65077020 GAAGCTGGCCCAGGAGCATGAGG + Intronic
1119772678 14:77230519-77230541 GAACCTGGCCCCGCAGCAGGAGG + Intronic
1119926055 14:78494921-78494943 GAACCTGGCCCCATATCAAGAGG - Intronic
1120256765 14:82130095-82130117 GAACCTGGCCCTAGAAGATGAGG - Intergenic
1121178794 14:91911693-91911715 CAACTGGGCCCCAGAGCATTTGG - Intronic
1121641252 14:95486167-95486189 TAGCCTTGCCCCAGAGCAGATGG - Intergenic
1122205571 14:100146358-100146380 GAGCCTGGCCCCAGGGAATGGGG - Exonic
1202833006 14_GL000009v2_random:57453-57475 TGACCAGGCCCCAGAGCAACGGG - Intergenic
1124022877 15:25939821-25939843 CCACCTGGCTCCAGAGCATGGGG + Intergenic
1124393099 15:29277638-29277660 GAACCTGGCCGCACAGCAGGAGG - Intronic
1125442843 15:39722014-39722036 GAACCGGGCCCCAGAGCAGGAGG + Intronic
1125472552 15:40019111-40019133 GGAACTGGCCCCAGAGCTTGTGG - Exonic
1127379070 15:58413382-58413404 GAACCTGGCCACACAGCAGGAGG + Intronic
1127516308 15:59696588-59696610 GAGCCTTGCTCCAGAGCATGTGG + Intergenic
1128426384 15:67545667-67545689 CAACCTGGCTCCAGAGTTTGTGG - Intronic
1129827666 15:78645194-78645216 TCACTTGGCTCCAGAGCATAGGG - Intronic
1129888961 15:79058453-79058475 GACCCTCGCCACAGAGCATGAGG - Exonic
1131063252 15:89417331-89417353 TACCTTCGCCCCAGAGCAGGCGG + Intergenic
1133119982 16:3600285-3600307 GAACCTGGCCACACAGCAGGAGG - Intronic
1134102522 16:11462070-11462092 TAACCTGGCCACAGAGCAGAGGG + Intronic
1134679449 16:16114007-16114029 GAACCAGGCCCCACAGCAGGAGG - Intronic
1135545439 16:23362796-23362818 AGACCTCGCCCCAGGGCATGGGG - Intronic
1135893687 16:26379396-26379418 TTCCCTGGCCTAAGAGCATGGGG + Intergenic
1135904301 16:26496926-26496948 TAACCAGGCCACACAGCAGGAGG + Intergenic
1137717843 16:50609802-50609824 TAAGCAGGCCCCAGATCAAGGGG + Intronic
1139159686 16:64489485-64489507 AAGCCTGGACCCAGAGCCTGTGG + Intergenic
1139375078 16:66491852-66491874 GAACCTGGCCGCACAGCAGGAGG - Intronic
1139534701 16:67563814-67563836 TCACCTAGCCCTAGAGCATCAGG - Intronic
1140117581 16:72056182-72056204 AAAGCTGTCCCCAGAGCAGGAGG - Exonic
1142184783 16:88689520-88689542 CTACGTGCCCCCAGAGCATGGGG - Intergenic
1142284351 16:89165673-89165695 TTCCAGGGCCCCAGAGCATGCGG + Intergenic
1142286408 16:89173240-89173262 AACCCTGTCCCCAGAGCAGGTGG - Intronic
1143369066 17:6427054-6427076 CAACCTGGCCCCAGAGCTGCAGG + Exonic
1144045459 17:11450878-11450900 AAACCTGGACCCAGCGCTTGAGG - Intronic
1144450177 17:15370589-15370611 GAACCAGGCCTCAGAGCAGGAGG - Intergenic
1145982531 17:29021745-29021767 TAAACTGGACCCAGAGGAGGTGG - Intronic
1148211140 17:45809385-45809407 TAACCTGGCCCCAGAGCATGGGG - Intronic
1148654633 17:49274067-49274089 TAACTGGGCCCCAGAGCATGGGG - Intergenic
1150224598 17:63517116-63517138 TGACTTGGCACCAAAGCATGTGG + Intronic
1152657524 17:81526990-81527012 CACCCTGGCCCCTGAGCGTGGGG + Intergenic
1155285275 18:24281854-24281876 GAACCTGGCCACACAGCAAGAGG + Intronic
1155692969 18:28649690-28649712 GAACCTGGCCGCAGAGCCAGAGG - Intergenic
1156276175 18:35584858-35584880 AAACCTGGCCACACAGCAGGAGG - Intronic
1158137322 18:54222369-54222391 AATCCTGGCCCCACAGCCTGAGG + Intronic
1159540097 18:69764012-69764034 TCACCTTGCGCAAGAGCATGGGG - Intronic
1161238972 19:3211341-3211363 TCACCTGACTCCGGAGCATGGGG + Intergenic
1161238990 19:3211401-3211423 TTACCTGACCCCGGAGCATGGGG + Intergenic
1161391924 19:4025544-4025566 GAACCTGGCCCCACAGCAGGTGG - Intronic
1165895112 19:39136648-39136670 TAACGTAGCCTCAGGGCATGGGG + Intronic
1167467143 19:49656275-49656297 TTGCCTGGCCCCACAGGATGTGG - Intronic
1167514121 19:49913052-49913074 GAACCTGCTCCCACAGCATGTGG - Intronic
925029988 2:642999-643021 TCTGCTGGCCCCAGAGCTTGGGG - Intergenic
925100189 2:1237775-1237797 TACCCTGGACCCAGGACATGGGG - Intronic
927936540 2:27079514-27079536 TATCCTAGCCCCAGAGCCTCAGG + Intronic
932840165 2:75074438-75074460 TAACATGGCCCTACAGCATGTGG + Intronic
935099818 2:99982681-99982703 TATCCTGGGTCCATAGCATGAGG - Intronic
937014238 2:118589069-118589091 AAACCAGGCCCCACAGCAGGAGG - Intergenic
937560491 2:123218593-123218615 TAAACTGGTCCCAGAGCCAGTGG + Intergenic
939236114 2:139495992-139496014 TAACCAGGCCACACAGCAGGAGG + Intergenic
939440586 2:142244677-142244699 GAACCTGGCCACACAGCAGGAGG + Intergenic
942409932 2:175698286-175698308 TGACTTGGGCACAGAGCATGTGG - Intergenic
942734803 2:179097324-179097346 TGAACTGGGCCCAGAGCCTGTGG - Intergenic
944483443 2:200180113-200180135 CAACATGGCCACAAAGCATGGGG - Intergenic
946146522 2:217735234-217735256 GAACCAGGCCACAGAGCAGGAGG - Intronic
946149845 2:217756807-217756829 GATCCTGGCCCCAGGGCCTGGGG - Intergenic
946587289 2:221203993-221204015 TAACATGGCCCTAAAGCTTGTGG + Intergenic
947561726 2:231160010-231160032 GAACCTGGCTGCAGAGCAGGAGG - Intronic
948295498 2:236857270-236857292 TAACCCAGCCCCAGAGAGTGGGG - Intergenic
948420366 2:237856315-237856337 GAACCTGGCCTCACAGCAGGAGG - Intergenic
948734697 2:239994226-239994248 GAACCTGGCCACACAGCAGGAGG + Intronic
948776807 2:240293438-240293460 CAGCCTGGCCCCAGGGCATTAGG - Intergenic
948892246 2:240913163-240913185 GAACCTGGCTCCAGACCGTGAGG - Intergenic
1169322019 20:4640782-4640804 GAACCGGGCCCCACAGCAGGAGG + Intergenic
1170696971 20:18667808-18667830 TGACCTGGCCCCAGAGGCAGAGG - Intronic
1171508641 20:25661103-25661125 GAACCGGGCCACAGAGCAGGAGG - Intergenic
1172447656 20:35001574-35001596 TCACCTGGCCACAGACCCTGGGG - Intronic
1175004218 20:55665249-55665271 TTCCATGGCCCCAGAGCAGGTGG + Intergenic
1175550816 20:59816297-59816319 GAACCTGGCCACACAGCAGGAGG - Intronic
1176364091 21:6022198-6022220 TAGCCTGGCCCCACTGCAGGTGG - Intergenic
1177535811 21:22425353-22425375 TAACCTAGCCGCACAGCAGGAGG - Intergenic
1179759427 21:43516347-43516369 TAGCCTGGCCCCACTGCAGGTGG + Intergenic
1179799208 21:43803043-43803065 TAAACTGGCCCCAGGGCCTAGGG + Intronic
1179914618 21:44468020-44468042 TCACGTGGACCCAGAGCCTGTGG + Intergenic
1182027019 22:27128190-27128212 TAACCTGGCCCCATAATATATGG + Intergenic
1182183713 22:28378561-28378583 TCACCTGACCCCAGAGGTTGGGG + Intronic
1182576848 22:31278624-31278646 TAACTAGGCCCCAGAACCTGTGG - Intronic
1185088651 22:48754020-48754042 TACCCTGGCCCCAGGGCCTCAGG - Intronic
1185100255 22:48836528-48836550 TAGCCTGGTCCCAGATCGTGGGG + Intronic
1185137015 22:49078987-49079009 CCAGCTGGCTCCAGAGCATGGGG - Intergenic
950188326 3:10958961-10958983 AAACCTGGCTCCAGAGCCTGAGG - Intergenic
950966076 3:17146681-17146703 TTACTTGGCCTCAGAGTATGTGG + Intergenic
951852873 3:27162542-27162564 TAATGTGGGCCCTGAGCATGTGG + Intronic
952852191 3:37738577-37738599 CAGCTTGGCCCCAGAGCATGAGG + Intronic
952946140 3:38478926-38478948 AAGCTAGGCCCCAGAGCATGAGG - Intronic
954647811 3:52142267-52142289 TAACGTGGGCTCAGAGCATATGG + Intronic
955347393 3:58171294-58171316 TAAGAAGGCCACAGAGCATGGGG - Intronic
956906062 3:73766613-73766635 AATTCTGGCCCCAGAGCATTTGG + Intergenic
957709548 3:83838374-83838396 AAACCTGGCCACAGAGCAAGAGG + Intergenic
961614486 3:128168126-128168148 TAAACTTGCCCCAGAGCTTGGGG + Intronic
962318168 3:134371476-134371498 GCACCTGGCCCCAGAGCACCTGG + Exonic
962446729 3:135472559-135472581 GAGGCTGGCCCCAGAACATGAGG - Intergenic
965118392 3:164520534-164520556 TGAACTGGGCCCAGAGCAAGTGG - Intergenic
968878865 4:3288444-3288466 TTTCCTGGCCCCAAAGCATGGGG - Intergenic
969574547 4:8029438-8029460 TCACCTCGCCCCAAGGCATGAGG + Intronic
971754935 4:30695403-30695425 TAACCTGGGCCCAGTGCAGTGGG + Intergenic
971766206 4:30835261-30835283 TAACCGGGCCACACAGCAGGAGG + Intronic
972289351 4:37677177-37677199 AAACCAGGCCCTTGAGCATGAGG + Intronic
972368625 4:38399682-38399704 GAACCTGGCCGCACAGCAGGAGG + Intergenic
973272123 4:48271882-48271904 GAACCTGGCCGCATAGCAGGAGG - Intergenic
973275328 4:48301123-48301145 GAACCTGGCCACACAGCAGGAGG + Intergenic
973323700 4:48835725-48835747 GAACCTGGCCCCAGCACATTGGG + Intronic
973391113 4:49558787-49558809 TGACCAGGCCCCAGAGCAAAGGG - Intergenic
974819208 4:67045007-67045029 TACCCTGCCCCCACAGCAAGAGG + Intergenic
976705625 4:88016157-88016179 GAACCGGGCCCCACAGCAGGAGG - Intronic
978291225 4:107143298-107143320 CAACCTGGCCGCACAGCATGAGG + Intronic
980291337 4:130850213-130850235 AAACTTGGCACGAGAGCATGAGG - Intergenic
981027661 4:140093116-140093138 TAACTTGGCCCCAAAGTGTGAGG + Intronic
981045023 4:140256896-140256918 GAACCTGCCCCCAGAGCAGGTGG + Intergenic
981860307 4:149347379-149347401 GAACCTGGCCCCATACCAGGCGG + Intergenic
982880928 4:160714231-160714253 TTCCCAGGCTCCAGAGCATGGGG - Intergenic
984068591 4:175082278-175082300 TGACCTGGGCCCAGAGCTAGTGG - Intergenic
984376830 4:178942151-178942173 GAACCTGGCCACACAGCAGGAGG + Intergenic
986580747 5:9263292-9263314 GAACCAGGCCGCACAGCATGAGG + Intronic
986662399 5:10071099-10071121 TCAGCTGGCCCCAGGGCCTGGGG + Intergenic
987094378 5:14535069-14535091 GAACCAGACTCCAGAGCATGGGG - Intergenic
987151596 5:15046215-15046237 CAGCCTGGGACCAGAGCATGTGG + Intergenic
988882279 5:35516602-35516624 GAACCAGGCCCCACAGCAGGAGG + Intergenic
990972168 5:61520023-61520045 GAACCTGGCCACACAGCAGGAGG - Intronic
991527575 5:67578835-67578857 TCTCCTGCCCTCAGAGCATGAGG + Intergenic
991625213 5:68594088-68594110 GAACCAGGCCACAGAGCAGGAGG + Intergenic
991677767 5:69105737-69105759 GAACCAGGCCACAGAGCAGGAGG + Intronic
993949560 5:94157273-94157295 CAACCTGGCCCCACAGCTGGTGG + Intronic
997262945 5:132477849-132477871 TAACTTGGCCTCAGTGCAGGGGG - Intergenic
999168775 5:149575083-149575105 TAAGCAGGCACCAGATCATGAGG - Intronic
999421912 5:151451822-151451844 AAAGCTGGCCCCAGAGCCTGGGG - Intronic
1000609401 5:163358020-163358042 GAACCTGGCCACACAGCAAGAGG + Intergenic
1001843019 5:174895603-174895625 GAACCAGGCCACAGAGCAGGAGG - Intergenic
1003007214 6:2393083-2393105 GAACCAGGCCACAGAGCAGGAGG - Intergenic
1003164949 6:3669539-3669561 TAAGCTGGCCCCAAAAGATGGGG + Intergenic
1003780050 6:9414897-9414919 TAACATGGCACCAGACCAAGGGG + Intergenic
1004337734 6:14779786-14779808 TAAGCTGGGCCTTGAGCATGGGG + Intergenic
1005297359 6:24439244-24439266 AACACTGGCCCCAGTGCATGTGG + Intronic
1007406189 6:41637576-41637598 GAACCTGGTCCCCGAGAATGGGG - Intronic
1011752869 6:90470978-90471000 GAACCTGGGTACAGAGCATGTGG - Intergenic
1017058507 6:150459310-150459332 GAACCTGGCACAACAGCATGGGG + Intergenic
1017070456 6:150571380-150571402 TAACTTGGAACCAGACCATGAGG - Intergenic
1017727430 6:157285263-157285285 TCACCGGGGCCCAGAGCATGGGG + Intergenic
1018277680 6:162150366-162150388 TATGCTGTCTCCAGAGCATGAGG + Intronic
1018645973 6:165948813-165948835 TAAGCTGGCCCCACAGCAGTAGG + Intronic
1019048336 6:169164741-169164763 GAACTGGGCCCCAGAGCAGGGGG - Intergenic
1019128674 6:169858511-169858533 TGACCTGGCCGCAGAGCTTCAGG + Intergenic
1020433759 7:8140324-8140346 AAACCATGCTCCAGAGCATGAGG - Intronic
1021203664 7:17753743-17753765 TGAACTGGCCCCAGAGCCAGTGG - Intergenic
1026533258 7:71218596-71218618 GAACCTGGCCTCACAGCAGGAGG + Intronic
1026564121 7:71475603-71475625 GAACCTGGCCACATAGCAGGAGG - Intronic
1027613043 7:80386835-80386857 TAACAAGGCCCCAGATGATGCGG - Intronic
1029306664 7:99624728-99624750 TGACCTGGGCTCAGAGCCTGGGG + Intronic
1031773079 7:125870408-125870430 CCACCTGGCCCCAGACCATTGGG - Intergenic
1032231228 7:130076247-130076269 GAACCTGGCCACATAGCAGGAGG - Intronic
1035470771 7:159107337-159107359 CCTCCTGGCCCCTGAGCATGGGG + Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1037319647 8:17630975-17630997 TCACCTGACTCCAGAGCACGTGG + Intronic
1038105686 8:24431335-24431357 CAACAAGGCCCCAGAGCAAGTGG + Intergenic
1039608246 8:38900503-38900525 CTTCCTGCCCCCAGAGCATGAGG - Intergenic
1040546240 8:48400182-48400204 GAACCTGGCCACACAGCAGGAGG + Intergenic
1041702875 8:60810862-60810884 GAACCTGGCCGCACAGCAGGAGG + Intronic
1042941322 8:74111789-74111811 TAACCCAGACCCAGAGCAAGGGG - Intergenic
1043308832 8:78832546-78832568 GAACCTGGCCGCACAGCAGGAGG - Intergenic
1043541590 8:81269516-81269538 TAACCTGGCCACAAAGCCAGGGG + Intergenic
1044136707 8:88594742-88594764 GAACCTGGCCGCACAGCAGGAGG - Intergenic
1044677956 8:94748572-94748594 GAACCTGGCCTCACAGCAGGAGG + Intronic
1044945793 8:97388074-97388096 GAACCAGGCCACACAGCATGAGG + Intergenic
1047809063 8:128388168-128388190 CAACCTGGTCTCAGAGCCTGAGG + Intergenic
1048136567 8:131752136-131752158 GAACCTGGCCGCATAGCAGGAGG + Intergenic
1048378752 8:133845654-133845676 TAAGATGGTCCCTGAGCATGAGG + Intergenic
1048969719 8:139638697-139638719 TTGCCCGGCCCCAGAGCCTGAGG - Intronic
1049408253 8:142461127-142461149 CAGCATGGCCCCAGAGCAGGTGG - Intronic
1051193208 9:14535772-14535794 TAAGCCAGCCCCAGAGCCTGGGG - Intergenic
1051789698 9:20786948-20786970 AATCCTGGCCCCATAGCCTGAGG - Intronic
1052352009 9:27467632-27467654 TAACATCGCCCCAGGGCAAGTGG + Intronic
1052564729 9:30134688-30134710 TAACCAGGCCACACAGCAGGAGG - Intergenic
1053306052 9:36985661-36985683 GCGCCTGGCCACAGAGCATGGGG + Intronic
1053671092 9:40362928-40362950 TAACCTGAAGCCAGAGGATGAGG - Intergenic
1054513522 9:66013372-66013394 TAACCTGAAGCCAGAGGATGAGG + Intergenic
1060054597 9:120402782-120402804 TAACCTGACCACAGAGCTGGGGG - Intronic
1060394614 9:123306732-123306754 TGAACAGGCCCCAGAGCATAGGG + Intergenic
1061288380 9:129637208-129637230 TGACCTGGCCCCAGAGCTACAGG + Exonic
1061937254 9:133864628-133864650 TTCCCAGGCCCCAGAGCCTGTGG - Intronic
1062001523 9:134218299-134218321 CTGCCTGGCCCCAGAGCCTGGGG - Intergenic
1185667093 X:1774511-1774533 GAACCGGGCCACAGAGCAGGAGG - Intergenic
1186072980 X:5842863-5842885 CATTCTGGCCCCAGAGCTTGTGG - Intronic
1188356628 X:29199708-29199730 TAACCAGGCCGCACAGCAGGAGG - Intronic
1189641923 X:43081930-43081952 GAACCTGGCCACACAGCAGGAGG + Intergenic
1189642129 X:43084625-43084647 GAACCTGGCCACACAGCAGGAGG - Intergenic
1189868875 X:45361052-45361074 TGACCTGGGCCCAGAGCCAGTGG - Intergenic
1190137227 X:47807959-47807981 TCACCTGACCTCAGGGCATGGGG + Intergenic
1190777171 X:53562212-53562234 TATCCTGGACCCTGAGGATGAGG - Exonic
1192780268 X:74286879-74286901 TTACCTGGGCCCTGAGGATGAGG + Intergenic
1193218562 X:78895311-78895333 TATTCTGGCCCCATAGAATGAGG + Intergenic
1195998629 X:110757931-110757953 TGACCCAGACCCAGAGCATGGGG - Intronic
1196063882 X:111441563-111441585 TAATCTGACCCCAAAGCCTGTGG - Intergenic
1196608672 X:117685724-117685746 GAACCTGGCCACATGGCATGAGG + Intergenic
1197075663 X:122350118-122350140 TAAGCTGGGCCCAGAGACTGTGG + Intergenic
1197590387 X:128402443-128402465 TAAACTGGACCCAGAGACTGTGG - Intergenic
1198790935 X:140345020-140345042 CAATCTGGCCCCAGAGCCTGTGG - Intergenic
1199908378 X:152259334-152259356 TAAACTGGGCCCAGAGCCAGTGG + Intronic