ID: 1148211311

View in Genome Browser
Species Human (GRCh38)
Location 17:45810526-45810548
Sequence GCCACCAGCACTGCGTTATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148211310_1148211311 -7 Left 1148211310 17:45810510-45810532 CCTGACTTCAGATTTTGCCACCA 0: 1
1: 0
2: 1
3: 22
4: 338
Right 1148211311 17:45810526-45810548 GCCACCAGCACTGCGTTATGCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1148211309_1148211311 2 Left 1148211309 17:45810501-45810523 CCATGTGGGCCTGACTTCAGATT 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1148211311 17:45810526-45810548 GCCACCAGCACTGCGTTATGCGG 0: 1
1: 0
2: 0
3: 9
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148211311 Original CRISPR GCCACCAGCACTGCGTTATG CGG Intronic
903924353 1:26821074-26821096 GACACCAGCATTGCTGTATGCGG + Intergenic
905755947 1:40509068-40509090 GCCAACAGCACTGTGTTCCGAGG - Exonic
907422348 1:54355918-54355940 GGCACGAGCACTGCGTTAATGGG - Intronic
908902724 1:68974666-68974688 GCCACTTGCACTGCATTATGTGG + Intergenic
910146430 1:84085841-84085863 GCCACCAGGACTGCACTGTGGGG - Intronic
911730041 1:101283270-101283292 GCCACCAATACTGCTTTAGGGGG - Intergenic
1065145289 10:22762327-22762349 GCCACGATCACAGCATTATGTGG - Intergenic
1066762023 10:38764327-38764349 GCTACCAGCACTGCACTGTGAGG - Intergenic
1066959568 10:42208143-42208165 GCTACCAGCACTGCACTGTGAGG + Intergenic
1072574228 10:96685629-96685651 GTCACCAGCTCTGGGTTATGGGG - Intronic
1094655857 12:32418991-32419013 GCCATCACCACTGGCTTATGGGG + Intronic
1104590629 12:130081684-130081706 GCCTCCATCACTGCGGTATTTGG - Intergenic
1113786464 13:113004444-113004466 CCCCCCAGCACTGCGCCATGGGG - Intronic
1115455796 14:33600940-33600962 GCCATGAGCACTGCATTCTGGGG + Intronic
1116325793 14:43533136-43533158 GCCACCAGCCCTGGGTAGTGAGG + Intergenic
1117893411 14:60450919-60450941 GCAAACAGCACAGCGTTATTGGG + Intronic
1118084364 14:62398461-62398483 GCCACCAACACAGCCCTATGGGG + Intergenic
1124638853 15:31382543-31382565 GTCACCAGCCCTGTGTCATGGGG - Intronic
1129608274 15:77035309-77035331 GCCACCAGGACTACTTTCTGGGG + Intronic
1131291545 15:91111101-91111123 GCCACCAGTCCTGTGATATGAGG - Intronic
1132382885 15:101378944-101378966 GCCACCAGCACAGCACAATGCGG - Intronic
1137600767 16:49754731-49754753 GCCTCCTGCACTGCTTAATGAGG + Intronic
1142115813 16:88355569-88355591 ACCACCAGCACTGAGATCTGAGG - Intergenic
1146860928 17:36297850-36297872 GCCACCAGCATTTCCTTCTGCGG + Intronic
1147091259 17:38101954-38101976 GCCACCAGCATTTCCTTCTGCGG + Intergenic
1147105953 17:38218551-38218573 GCCACCAGCATTTCCTTCTGCGG - Intergenic
1148211311 17:45810526-45810548 GCCACCAGCACTGCGTTATGCGG + Intronic
1148423556 17:47569959-47569981 GCCACCAGCATTTCCTTCTGCGG + Intronic
1152162658 17:78678629-78678651 GGCACCAGCCCTGTGTTCTGGGG - Intronic
1155144767 18:23074167-23074189 GTCTCCTGCACTGCGCTATGTGG - Intergenic
1166946869 19:46402777-46402799 TGCACCAGCACTGCGTGATGTGG - Intergenic
1167390381 19:49190783-49190805 GCCTCCAGCACTGTGTGAGGTGG + Intronic
1168125628 19:54280931-54280953 TCCATCAGCACAGCGTTGTGGGG + Intronic
925606537 2:5666290-5666312 GCCACCTGCAGTGGGTTATGTGG - Intergenic
928300952 2:30123073-30123095 GCCACCACCACTGGGTGCTGTGG + Intergenic
930032439 2:47066607-47066629 ACAAGCAGCCCTGCGTTATGGGG + Intronic
930070350 2:47361146-47361168 GCCACCACCACTACTTTGTGGGG + Intronic
930554220 2:52874972-52874994 GTCACCAGCCCTGCGGTAAGAGG + Intergenic
934016347 2:87889073-87889095 GCAACCTGCAATGTGTTATGAGG + Intergenic
934463710 2:94239722-94239744 GCTACCAGCACTGCACTGTGAGG - Intergenic
934776856 2:96944519-96944541 GCCACCACCACTGTGTTCTCAGG - Intronic
935147729 2:100407567-100407589 GCCATCAGCACTGTGTTGAGGGG - Intronic
942046864 2:172104448-172104470 CCCACCTGCATTGCTTTATGCGG + Intergenic
1168906141 20:1405261-1405283 GCCACCACCACTGAGCCATGTGG - Intergenic
1170156286 20:13272458-13272480 CCCTCCAGCACTGTTTTATGTGG - Intronic
1175722930 20:61298253-61298275 GCCACCAGCTCTGCATCATCAGG + Intronic
1176259626 20:64172704-64172726 GCCAGCAGCACTGGGTTTGGGGG - Intronic
1177043407 21:16140925-16140947 GACACCACCACTGAGTGATGGGG + Intergenic
1177745637 21:25210243-25210265 TCTACCACCACTGCGTTTTGTGG + Intergenic
1180584842 22:16878720-16878742 GCTACCAGCACTGCACTGTGAGG - Intergenic
1181884561 22:26010006-26010028 CCCACCAGCCCTGTGTTATCAGG + Intronic
1182142002 22:27967633-27967655 GCCACCACCACTGCCCTGTGGGG + Intergenic
1182389792 22:29983543-29983565 GCCTCCAGCACTGCTTTCAGAGG - Intronic
1183216029 22:36480715-36480737 GCCACCAGGACTGCATTGTGGGG + Exonic
954808571 3:53234286-53234308 GCCTCCAGGACTGCGTTTTGCGG - Intronic
957357930 3:79115986-79116008 GGCACCATAACTGCCTTATGAGG + Intronic
966770745 3:183501361-183501383 GCCACCAGCACTAATCTATGTGG + Intronic
968296580 3:197581513-197581535 GCCACAAGCACAGCCTAATGCGG + Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
980878778 4:138688392-138688414 GCCCCCATCACTGCCTTAAGAGG + Intergenic
985400477 4:189588381-189588403 GGCACCACCACGGCGTGATGCGG - Intergenic
985476470 5:82055-82077 GCCACCAGCCCTGCCTTCAGTGG - Intergenic
991937449 5:71816050-71816072 GCAACCAGCACTGCCTTCTATGG - Intergenic
1001992569 5:176130156-176130178 CCCCCCAGCACTGTGTTATCTGG + Intronic
1002002288 5:176203569-176203591 CCCCCCAGCACTGTGTTATCTGG + Intergenic
1002224304 5:177707990-177708012 CCCCCCAGCACTGTGTTATCTGG - Intronic
1022790758 7:33686726-33686748 GTCACCAGCTCTGCCTTGTGTGG + Intergenic
1023813008 7:43926768-43926790 GCCACGAGGGCTGCGTCATGCGG + Intronic
1023937433 7:44749432-44749454 CCCACCAGCACGGCGATGTGGGG + Intronic
1028621974 7:92835693-92835715 GCCACCAGCACAGCGACAAGAGG + Intronic
1034552464 7:151830309-151830331 GCCACCTGCACTGTGCTGTGTGG + Intronic
1035716367 8:1758104-1758126 GCCATCGGCACTGTGTTTTGTGG + Intronic
1045040417 8:98218824-98218846 TACAACAGCACTGCGTTATGTGG + Intronic
1045040558 8:98219816-98219838 TAGAACAGCACTGCGTTATGTGG - Intronic
1047042261 8:121008941-121008963 GCTACCAGCTCTGAATTATGTGG - Intergenic
1047100832 8:121674258-121674280 GCCACAAGCACAGTATTATGGGG - Intergenic
1048914726 8:139171149-139171171 GCCACCCCCACTGCTTTGTGGGG + Intergenic
1051038056 9:12773196-12773218 GCTACCATAACTGCTTTATGTGG - Intergenic
1053288026 9:36862403-36862425 GTCCCCAGCACCGCGTTCTGGGG + Intronic
1053940769 9:43246802-43246824 GCTACCAGCACTGCACTGTGAGG - Intergenic
1054803518 9:69376652-69376674 GCTACCAGCTCTGGGTTGTGTGG + Intronic
1056863923 9:90213006-90213028 GCCTCCAGCCCTGCAGTATGAGG + Intergenic
1056915976 9:90746412-90746434 GCCTCCAGCCCTGCAGTATGAGG - Intergenic
1060732854 9:126049126-126049148 GCCACGAGCAATGCTTTATGGGG + Intergenic
1186826596 X:13346546-13346568 GACACCAGCACTGCAGTCTGAGG - Intergenic
1192135102 X:68589536-68589558 GCCACCACCACTGCTCCATGGGG - Intergenic
1196228086 X:113189500-113189522 GCCACCATCACTGTGTTCTTTGG - Intergenic
1199128138 X:144149467-144149489 GCAACCTGCAATGTGTTATGAGG - Intergenic
1200724154 Y:6645384-6645406 CCCACCAGCAATGCATTATGGGG + Intergenic