ID: 1148213219

View in Genome Browser
Species Human (GRCh38)
Location 17:45820491-45820513
Sequence CCTTCTAAGGAGATGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 303}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148213219_1148213229 -9 Left 1148213219 17:45820491-45820513 CCCCTCCCCATCTCCTTAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 303
Right 1148213229 17:45820505-45820527 CTTAGAAGGTGACAGGTTCTGGG 0: 1
1: 0
2: 1
3: 24
4: 158
1148213219_1148213231 7 Left 1148213219 17:45820491-45820513 CCCCTCCCCATCTCCTTAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 303
Right 1148213231 17:45820521-45820543 TTCTGGGCCACAGTCCAGGCCGG 0: 1
1: 0
2: 2
3: 42
4: 376
1148213219_1148213232 10 Left 1148213219 17:45820491-45820513 CCCCTCCCCATCTCCTTAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 303
Right 1148213232 17:45820524-45820546 TGGGCCACAGTCCAGGCCGGTGG 0: 1
1: 0
2: 1
3: 20
4: 218
1148213219_1148213228 -10 Left 1148213219 17:45820491-45820513 CCCCTCCCCATCTCCTTAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 303
Right 1148213228 17:45820504-45820526 CCTTAGAAGGTGACAGGTTCTGG 0: 1
1: 0
2: 0
3: 14
4: 164
1148213219_1148213230 3 Left 1148213219 17:45820491-45820513 CCCCTCCCCATCTCCTTAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 303
Right 1148213230 17:45820517-45820539 CAGGTTCTGGGCCACAGTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148213219 Original CRISPR CCTTCTAAGGAGATGGGGAG GGG (reversed) Intronic
901741621 1:11345536-11345558 CCTTCAAAGGTGGTGGGCAGGGG + Intergenic
902688749 1:18096480-18096502 CATTCTCAGGAGATGGGGCCAGG + Intergenic
902705744 1:18202998-18203020 ACTTCTAAGGAAGTTGGGAGTGG + Intronic
902760943 1:18580458-18580480 CCTAGTGAGGAGATGGGGAGGGG - Intergenic
903071699 1:20730036-20730058 CCAGGTAAGGAGGTGGGGAGGGG + Intronic
903989607 1:27257249-27257271 CCTTCTAAGGAAAAGGGTATTGG + Intronic
904345926 1:29869452-29869474 CTTTCTAAGGATATGGAGGGTGG - Intergenic
904621054 1:31775585-31775607 CTTTCCAGAGAGATGGGGAGAGG + Intergenic
905194051 1:36260354-36260376 GCTTCTAAGGGGCTGGGAAGGGG - Intronic
906253131 1:44326778-44326800 GGGTCTATGGAGATGGGGAGAGG - Intronic
906379703 1:45324753-45324775 CCTACTAGAGAGATGGGGACAGG - Intergenic
906691744 1:47797435-47797457 CCTTGGAAGGAGAGGGGAAGTGG - Intronic
909264523 1:73539523-73539545 CCCTCTCTGGAGTTGGGGAGTGG - Intergenic
910347440 1:86256195-86256217 CCCACTAAGGAGATGGATAGAGG - Intergenic
910632506 1:89370297-89370319 CAATCTCAGGAGATGAGGAGAGG + Intronic
910826212 1:91410296-91410318 CCTTTCCAGGAAATGGGGAGAGG + Intergenic
911326075 1:96471172-96471194 CGTTCTATGTAGATGGGGTGTGG - Intergenic
912493217 1:110074030-110074052 TCTTCTTAGCAGATGGAGAGGGG - Intronic
913973242 1:143432738-143432760 ACTGCTATGGAGGTGGGGAGAGG + Intergenic
914067626 1:144258345-144258367 ACTGCTATGGAGGTGGGGAGAGG + Intergenic
914111527 1:144708009-144708031 ACTGCTATGGAGGTGGGGAGAGG - Intergenic
915247843 1:154568674-154568696 CTCTCTGAGGGGATGGGGAGGGG + Intronic
915313106 1:155014271-155014293 CCTTCCAAAGAGATGGGGAATGG + Intronic
916524814 1:165599575-165599597 CCTTCAAAAGAGAAGGGAAGGGG - Intergenic
916628983 1:166591665-166591687 CATTCTAAATAGATGGGGCGGGG - Intergenic
917647102 1:177040132-177040154 TCTGCGAAGGAGATGGGCAGGGG - Intronic
917670323 1:177267827-177267849 TCTTTTGAGGAGATGGGCAGTGG - Intronic
922785735 1:228281460-228281482 TCTTGTAACGAGATGGGAAGGGG + Intronic
923507888 1:234622015-234622037 CGTTTCAAGGAGGTGGGGAGGGG - Intergenic
923627812 1:235628403-235628425 CCTTGTTAGGAGACGGGGGGGGG + Intronic
924599864 1:245478990-245479012 CCATTAAATGAGATGGGGAGGGG + Intronic
1065088379 10:22203658-22203680 CCTTCTGAGGGGTTGGGGAAAGG + Intergenic
1065929196 10:30464113-30464135 CCTTATGAGAAGATGGGCAGTGG + Intergenic
1066088991 10:31999358-31999380 CCTTGTCAGGTGTTGGGGAGGGG + Intergenic
1068246710 10:54381232-54381254 TCTTCTAAGGAGAGGGGTATGGG - Intronic
1069595717 10:69668798-69668820 ACTTGTGAGGGGATGGGGAGAGG + Intergenic
1069747602 10:70725841-70725863 CCTTAAAAGGAGAGGGGCAGAGG - Intronic
1071516707 10:86302425-86302447 CCTTGTGGGGAGGTGGGGAGAGG - Intronic
1071835679 10:89415040-89415062 CCTTCTTAGGCGCTGGGGAGGGG - Intronic
1073322964 10:102626749-102626771 CCTTCTACGGTGAGGGGCAGAGG + Intronic
1074900100 10:117808910-117808932 CCCTAAAAGGAGGTGGGGAGTGG + Intergenic
1075800423 10:125150208-125150230 CCCTCGAGGGAGATGGGGGGTGG + Intronic
1076001213 10:126914567-126914589 TTTTTTAAGGAGATTGGGAGAGG + Intronic
1076149650 10:128151771-128151793 GCTTCTTAGGAGATGGCCAGTGG - Intergenic
1076794055 10:132790344-132790366 CCAGCTCAGGAGATGGGGTGGGG - Intergenic
1077138382 11:1012771-1012793 CCTACTAAGGGACTGGGGAGAGG + Intergenic
1077337479 11:2011931-2011953 CCCTCCATGGAGATGGGGTGTGG + Intergenic
1077362820 11:2148208-2148230 CCTTGGAAGGAGATAAGGAGGGG + Intronic
1077441708 11:2571991-2572013 CCTGCGAAGGAGATGGTGTGGGG - Exonic
1077752688 11:4990039-4990061 CTTTCTAAAGAGATGGTTAGAGG - Intronic
1077866169 11:6223529-6223551 CCTATCCAGGAGATGGGGAGAGG - Intronic
1078196041 11:9137958-9137980 GCTTCTGAAGAGATGAGGAGAGG - Intronic
1080928965 11:36787406-36787428 ACATCTAAGGGAATGGGGAGGGG + Intergenic
1081047425 11:38294328-38294350 GTTTGTATGGAGATGGGGAGAGG - Intergenic
1081402823 11:42662454-42662476 ACTTCAAAGGAGATGGGGTGGGG - Intergenic
1081577292 11:44327117-44327139 CATTCCAGGGAGGTGGGGAGGGG - Intergenic
1083035813 11:59636295-59636317 TCTTCAAAGGAGATGGGAAAAGG - Intergenic
1083178831 11:60971472-60971494 TCTTCTAAGAAGAAGGGAAGTGG - Intergenic
1084182539 11:67454108-67454130 GCTGCTAAAGAGAGGGGGAGGGG + Intronic
1085496689 11:76977383-76977405 CCTTCTAAGGAGGGTGGGTGAGG + Intronic
1086421391 11:86640909-86640931 CCCTCTGGGGAGATGGGGAAAGG - Intronic
1088897893 11:114091826-114091848 CCGGCTTAGGAGAGGGGGAGGGG - Intronic
1089073094 11:115716366-115716388 CTTTCTAAGGGGAAGGAGAGAGG + Intergenic
1089190739 11:116651475-116651497 CCTTCTCTAGACATGGGGAGTGG - Intergenic
1089536145 11:119161766-119161788 CCACCAAAGGTGATGGGGAGGGG - Exonic
1202820463 11_KI270721v1_random:67113-67135 CCCTCCATGGAGATGGGGTGTGG + Intergenic
1092117672 12:6020871-6020893 CCAGCAAAGGAGGTGGGGAGAGG + Intronic
1092284203 12:7119408-7119430 CCTTCTCTGGGGATGGGGGGTGG + Intergenic
1092532003 12:9352628-9352650 CCTTCTTGGGGGAGGGGGAGAGG - Intergenic
1093025407 12:14241012-14241034 GATCGTAAGGAGATGGGGAGGGG - Intergenic
1094224816 12:28033196-28033218 CCTTCTAAGCAGCTGGTGTGGGG - Intergenic
1095939579 12:47717264-47717286 CCTTCTAGGGGGAAGGGGCGGGG - Intronic
1096240295 12:49956203-49956225 CCTCCTCAGGAGAAGGGGAAGGG + Exonic
1096498151 12:52050568-52050590 CCCTGTAAGGGGCTGGGGAGGGG + Intronic
1096772698 12:53946123-53946145 TCTTCCAAGGGGATGGAGAGTGG + Exonic
1098427889 12:70386606-70386628 TTTTTTAAGGAGATGGGGAAAGG + Intronic
1101625114 12:106432939-106432961 ACTTCGAAGGAGACGGGAAGAGG - Intronic
1103998171 12:124843277-124843299 CTTTCTGTGGAGATGGGGGGGGG + Intronic
1105571223 13:21604320-21604342 CCTTCTAAGGCTGTGGGGATGGG + Intergenic
1106345229 13:28870493-28870515 CAATGTAAGGAGATGGGGAATGG - Intronic
1107329645 13:39285241-39285263 TCTTATAAGGAAGTGGGGAGTGG + Intergenic
1108478563 13:50843995-50844017 CCTTCGAAGGAGGTGGGGGCGGG - Intergenic
1112310139 13:98310897-98310919 CCTTCTTAGGTAATGGGGAAGGG - Intronic
1112726812 13:102313587-102313609 CCTTTTAAGGCGTTGGGCAGGGG + Intronic
1114749747 14:25189829-25189851 CCTTCTGTGGAGATGAGGATAGG + Intergenic
1116334442 14:43639371-43639393 CCTTGTAAGTGGATGGGGAAGGG + Intergenic
1117037138 14:51741223-51741245 CCTTATATCGAGAAGGGGAGAGG - Intergenic
1121386558 14:93532345-93532367 CCTTCTAAGCAGCTAGGCAGTGG - Intronic
1122215422 14:100200468-100200490 GCTTCCCAGGGGATGGGGAGTGG - Intergenic
1122616059 14:103018834-103018856 GCTTCCATGGGGATGGGGAGAGG + Intronic
1124163461 15:27295854-27295876 ACTTCAAAGGAGCTGGGGTGGGG + Intronic
1125731613 15:41895375-41895397 CCTGCTCAGGAAATGGTGAGTGG - Intergenic
1127372603 15:58355245-58355267 CCTTGAAGGCAGATGGGGAGTGG - Intronic
1127384972 15:58459966-58459988 CCTTCTTAGGAAAAAGGGAGAGG - Intronic
1127959779 15:63882212-63882234 TCTTCCAGGGAGATGGGAAGAGG + Intergenic
1127973254 15:63978716-63978738 ACTTGGAAGGAGATGGGGGGTGG - Intronic
1128109365 15:65067180-65067202 CCTTCTACGGGGAGGGGGTGTGG + Intronic
1128640147 15:69330118-69330140 TGTTCTATGAAGATGGGGAGAGG - Intronic
1128929359 15:71690347-71690369 CCATCCCAGGAGGTGGGGAGTGG - Intronic
1129686382 15:77688433-77688455 GCTTCTGATAAGATGGGGAGAGG + Intronic
1130510315 15:84583504-84583526 CCTTATAAGTGGATGGGGAAAGG - Intergenic
1131891118 15:96972397-96972419 CATTCTCAGGATGTGGGGAGAGG - Intergenic
1133658866 16:7895247-7895269 CCTGCAAAAGAGCTGGGGAGAGG + Intergenic
1134072379 16:11268837-11268859 CCCTTTAAGGAGGTGGGGAAGGG - Intronic
1134370655 16:13621075-13621097 CCTTCTAAACAGAAGAGGAGCGG - Intergenic
1134984202 16:18637656-18637678 CCTCATAAGGAGGTGGGGCGTGG + Intergenic
1136081162 16:27853468-27853490 CCCTCTGAGGACACGGGGAGGGG + Intronic
1137038940 16:35591952-35591974 CCATCCCAAGAGATGGGGAGAGG - Intergenic
1139253559 16:65519705-65519727 CATTATAAAGAGAAGGGGAGAGG - Intergenic
1140233443 16:73137459-73137481 CCTTCTAAGGAGATTAAGAACGG + Intronic
1141491602 16:84377684-84377706 CTTTCTGAGGATATGGGGTGTGG + Intronic
1141499907 16:84436738-84436760 CCTTCGCTGGCGATGGGGAGGGG - Intronic
1141665092 16:85461863-85461885 CGCTCTCAGGAGCTGGGGAGGGG - Intergenic
1141999658 16:87656949-87656971 CCTTATAAGAAGAGGAGGAGAGG - Intronic
1144664460 17:17092479-17092501 CCTTCTTAGTAGAGTGGGAGTGG + Intronic
1144717948 17:17447240-17447262 CCTTCTTAGGAGGTGGCTAGGGG + Intergenic
1145206860 17:20989123-20989145 CCTTCAAAGGAGATCTGGGGTGG - Intergenic
1146004896 17:29154957-29154979 CCTTCCAGGGACATGGCGAGGGG - Intronic
1146263936 17:31438705-31438727 CTTTCTCAGGAAACGGGGAGCGG - Intronic
1147137798 17:38444143-38444165 CCTTTGTAGGAGATGGGGAGGGG + Intronic
1147140570 17:38458504-38458526 GCTTCTCAGGAGACAGGGAGGGG + Intronic
1148134357 17:45282790-45282812 CCTGATTAGGAGATGGGGACCGG - Intronic
1148195285 17:45708657-45708679 CCTTGGAAGGAGAGGGGGAGTGG + Intergenic
1148213219 17:45820491-45820513 CCTTCTAAGGAGATGGGGAGGGG - Intronic
1148217038 17:45838980-45839002 CATTTTAAGGAGCTGGGGGGTGG - Intergenic
1149117284 17:53112579-53112601 CCTTCTTAGGAGATTGGAGGAGG - Intergenic
1149661446 17:58336214-58336236 CCCTCCAGGGAGATGGGGAAGGG - Intergenic
1149729847 17:58934451-58934473 CATTCTAAGGAGTTAGGGAATGG + Intronic
1150003946 17:61458006-61458028 GCCTCTCAGCAGATGGGGAGAGG + Intronic
1150028977 17:61711566-61711588 CATTCTAAAATGATGGGGAGTGG + Intronic
1151183015 17:72343330-72343352 CCACGTAAGGAGCTGGGGAGAGG + Intergenic
1153307152 18:3642133-3642155 CAATCTAATGAGATGGGGTGAGG - Intronic
1153775998 18:8454398-8454420 CCTTCTCAGGACATGGGTAGTGG + Intergenic
1153900160 18:9611491-9611513 CCTTCACAAGAGATGGGAAGTGG + Intronic
1154228982 18:12536562-12536584 CCTCATCAGTAGATGGGGAGTGG + Intronic
1156021688 18:32606582-32606604 GCTGCTAGGGGGATGGGGAGGGG + Intergenic
1157600096 18:48888441-48888463 GCTTCTCAGGAGAAGGGGGGCGG - Intergenic
1158447346 18:57532846-57532868 CCTGATAGGGAGATGGAGAGAGG - Intergenic
1158950857 18:62493323-62493345 CATTATAAGCAGATGGGGTGGGG - Intergenic
1159577717 18:70200275-70200297 CTTTCTAAGGAAATAAGGAGAGG + Intronic
1159787357 18:72730167-72730189 GCTTGTGAGGTGATGGGGAGGGG - Intergenic
1161075512 19:2283296-2283318 CCTTCTCAGGGGATTGGGGGAGG - Intronic
1161437342 19:4271626-4271648 TGTTCTAAGGAGATGCAGAGGGG + Intergenic
1161656198 19:5516770-5516792 CCTCCCAAGTAGATGGGGACTGG + Intergenic
1162910740 19:13846847-13846869 CCTTCTCCGGATGTGGGGAGTGG - Intergenic
1164829131 19:31307311-31307333 CCTTCCCAGAACATGGGGAGGGG - Intronic
1165981321 19:39726775-39726797 CCTCCTATGGAGATTGAGAGTGG + Intergenic
1167381098 19:49138452-49138474 CCTAGTAGGGGGATGGGGAGAGG + Intronic
1168523253 19:57069183-57069205 CCTCCCATGGAGAAGGGGAGCGG - Intergenic
925860587 2:8171899-8171921 CCCTCTAAGCACCTGGGGAGGGG + Intergenic
926760578 2:16275324-16275346 CCTTCCAAGGAGATGGGAAAAGG + Intergenic
928074131 2:28247501-28247523 CCTTCCATGAAGATGGGGAGGGG + Intronic
928252572 2:29694849-29694871 CGTTCTAAGGAGATGCCCAGAGG - Exonic
929841608 2:45470860-45470882 TTGTCTTAGGAGATGGGGAGAGG - Intronic
932369111 2:71173100-71173122 CCATCTAAGGAAATGGGGGGTGG - Intergenic
932463118 2:71896088-71896110 CCTTAGAAGGAGCTGGGAAGAGG - Intergenic
933456606 2:82526600-82526622 CCTTGTATCGAGAGGGGGAGAGG - Intergenic
934177938 2:89593695-89593717 ACTGCTATGGAGGTGGGGAGAGG + Intergenic
934288237 2:91667996-91668018 ACTGCTATGGAGGTGGGGAGAGG + Intergenic
935094417 2:99930681-99930703 CCTGCTATGCAGATGGGGGGAGG + Intronic
936017479 2:108970647-108970669 CCTGCTCAGGGGATGGGAAGAGG + Intronic
936637140 2:114271740-114271762 TCTTCAAAGGAGATGGGCACAGG + Intergenic
937716663 2:125039810-125039832 TCTTATGAGCAGATGGGGAGGGG - Intergenic
939000449 2:136728180-136728202 CCTTGTATGGTAATGGGGAGTGG + Intergenic
940277680 2:151956520-151956542 AGTTGGAAGGAGATGGGGAGTGG + Intronic
941416296 2:165225540-165225562 CCTTAGGAGGAGATGGAGAGAGG + Intergenic
941462891 2:165793285-165793307 TCCTCTAACGAGATGGTGAGTGG + Intronic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
943738505 2:191385002-191385024 CCTTGTTAGCAGAAGGGGAGAGG + Intronic
944010515 2:194969089-194969111 CATTCAAAGGAGGTGGAGAGAGG - Intergenic
945825144 2:214712473-214712495 CCCACTAGGAAGATGGGGAGAGG + Intergenic
946354230 2:219174956-219174978 CTCTTTAGGGAGATGGGGAGGGG + Intronic
946376048 2:219309418-219309440 CCTCGTAGGGAGGTGGGGAGCGG - Exonic
948826072 2:240573972-240573994 CCTCCCCAGGAGATGGGGACAGG - Intronic
948907028 2:240984481-240984503 GCCTCTCAGGTGATGGGGAGGGG - Intronic
948927748 2:241110418-241110440 TCATCCAGGGAGATGGGGAGAGG + Intronic
1168981443 20:2007327-2007349 TCTTCTGAGGGGGTGGGGAGAGG + Intergenic
1169146395 20:3255281-3255303 GCTTCTGCAGAGATGGGGAGTGG + Exonic
1171230723 20:23482060-23482082 CCTAATATGAAGATGGGGAGGGG - Intergenic
1171424788 20:25042652-25042674 CCCACTAGGGACATGGGGAGGGG + Intronic
1171973520 20:31579108-31579130 CCTCCTGAGTAGATGGCGAGAGG - Intergenic
1172082782 20:32355905-32355927 CTTTCTAGAGAGTTGGGGAGGGG + Intergenic
1172454905 20:35062686-35062708 CCTTGGGAGGAAATGGGGAGTGG + Intronic
1172794389 20:37527191-37527213 CCTTCTATAGACGTGGGGAGTGG - Intronic
1174709819 20:52692665-52692687 GCATGTAAGGAGCTGGGGAGTGG - Intergenic
1175091355 20:56507235-56507257 GCTACTGCGGAGATGGGGAGTGG - Intronic
1178369614 21:32016642-32016664 CCTTCTAAGGAGGTGGGGGTGGG + Intronic
1178626438 21:34222696-34222718 CCTCCTAGAGAAATGGGGAGAGG + Intergenic
1178849837 21:36203970-36203992 TCTTCTCAGGAGATGAGGAGAGG + Intronic
1179000436 21:37452635-37452657 CTGTCATAGGAGATGGGGAGGGG + Intronic
1180569108 22:16699284-16699306 CCAGCAAAGGAGGTGGGGAGAGG + Intergenic
1180955235 22:19738479-19738501 CCATCTCAGGGGTTGGGGAGGGG + Intergenic
1182423466 22:30259761-30259783 CCCTGGAAGGCGATGGGGAGAGG + Intergenic
1182917047 22:34043630-34043652 CCTGCCTGGGAGATGGGGAGGGG + Intergenic
1184135812 22:42549213-42549235 CCTTTTAGGGAGACTGGGAGAGG + Intergenic
1184889107 22:47368694-47368716 CCTTGTTGGGAGATGGGCAGGGG - Intergenic
1185014670 22:48335927-48335949 CCTTGTAAGGAGAGGAGAAGAGG - Intergenic
950287390 3:11755511-11755533 CCTGTTAAGGAGCTGGGGAAAGG + Intergenic
950433677 3:12966443-12966465 CCTTCTGAGGAGCAGGGGGGTGG - Intronic
950718433 3:14865834-14865856 CCTTCTTGGGAGAGGAGGAGTGG - Intronic
952925383 3:38316149-38316171 CCTTCAAGGGGGATGAGGAGGGG - Intronic
952956877 3:38563091-38563113 TCTTCAAAGAAGATGGGGACTGG + Intronic
953925789 3:46981859-46981881 CCTCCTGAGGGGATGGGGGGTGG - Intronic
954009090 3:47619128-47619150 AGTTCCCAGGAGATGGGGAGAGG - Intronic
955882982 3:63567442-63567464 CCATCTTGGGGGATGGGGAGGGG - Intronic
956508381 3:69967629-69967651 TCTCTTAAGGAGAAGGGGAGGGG - Exonic
958464666 3:94442995-94443017 CCTTCTGTGGAGAGCGGGAGTGG - Intergenic
958804771 3:98796541-98796563 CCTCTTCTGGAGATGGGGAGAGG + Exonic
959252262 3:103963987-103964009 CCTACTAAGGCAGTGGGGAGGGG + Intergenic
959729307 3:109582686-109582708 TTTTTTAAAGAGATGGGGAGTGG + Intergenic
960941967 3:122940804-122940826 TCTGCTAAGGACTTGGGGAGGGG - Intronic
961099383 3:124185737-124185759 CCTGCAAAGTAGGTGGGGAGAGG + Intronic
961519878 3:127460872-127460894 GCTTCTAAGATGATGGGGTGGGG - Intergenic
962235019 3:133700217-133700239 CATCCTAAGGAGGTGGGGGGTGG + Intergenic
962283900 3:134071174-134071196 GCTTCTAAGGACAGGGTGAGGGG - Intronic
963167521 3:142220616-142220638 CATTCTGAGGAGAAGGGTAGAGG - Intronic
963436373 3:145272665-145272687 TCATCCAAGGAGGTGGGGAGGGG - Intergenic
963583576 3:147156249-147156271 CCTAATAAAGAGATGAGGAGAGG + Intergenic
965209709 3:165768891-165768913 GCTGCTAAGGAGTGGGGGAGGGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
967608897 3:191481452-191481474 CCTTCTCATGAGAAGAGGAGGGG + Intergenic
967619544 3:191616382-191616404 GCTGCTATGGAGCTGGGGAGAGG - Intergenic
967972921 3:195012442-195012464 TCTCCTAAGCTGATGGGGAGAGG - Intergenic
968076018 3:195816496-195816518 CCTTGTAAGGAGAAGGGCGGAGG - Intergenic
969083932 4:4641369-4641391 GCTTCAAAGGGGATGGCGAGAGG + Intergenic
969387353 4:6863198-6863220 CCTTCAATAGTGATGGGGAGTGG + Exonic
971327799 4:25658392-25658414 CCATCTGAAGAAATGGGGAGAGG - Intronic
973642029 4:52913028-52913050 CCTTTTTGGGAGATTGGGAGAGG + Intronic
976054751 4:81050419-81050441 TCTTCTAAGGTGATGAGGAGAGG - Intronic
977809750 4:101346178-101346200 CCTTCCAGGGGGAGGGGGAGGGG + Intronic
978183300 4:105828887-105828909 CTCTCTTAGGAGTTGGGGAGAGG - Intronic
978348503 4:107797218-107797240 CTTGGGAAGGAGATGGGGAGGGG - Intergenic
979206119 4:118040366-118040388 TCATCTAAGGAAAGGGGGAGGGG + Intronic
979635721 4:122952875-122952897 CCTTCTAAAGAGGGCGGGAGAGG - Intronic
979665725 4:123308935-123308957 GTTTCTGAGAAGATGGGGAGAGG - Intronic
979962537 4:127037427-127037449 CCCTCTAAGGAGTGGGGGAAAGG + Intergenic
980952196 4:139392010-139392032 CCTTTTATGAAGATAGGGAGAGG + Intronic
981077187 4:140603398-140603420 CATTGTGAGCAGATGGGGAGGGG - Intergenic
982873886 4:160620056-160620078 CCTTGTAAGAAGAGGAGGAGAGG - Intergenic
984929199 4:184831747-184831769 GCATCTTAGGAGATGGGCAGGGG - Intergenic
985880743 5:2637048-2637070 CCATCTCAGGAGAGGGGCAGTGG + Intergenic
986795945 5:11212309-11212331 CCTCCTTAGGAAATGGGGTGGGG + Intronic
987652083 5:20754942-20754964 GCTGCTAAGGAGTTGGGAAGTGG + Intergenic
987820607 5:22961515-22961537 CCTTATAAGAAGAGGAGGAGAGG - Intergenic
988328530 5:29803493-29803515 CCTTCAAAGAAGATGTGTAGAGG + Intergenic
988688263 5:33547116-33547138 CCATCTGAGGAGAGAGGGAGAGG + Intronic
988743479 5:34106539-34106561 GCTGCTAAGGAGTTGGGAAGTGG - Intronic
989987309 5:50716147-50716169 CCTTCTATGGAGAAGGGAAGAGG + Intronic
991016671 5:61940676-61940698 CCCTGTAAGGAGATGAGCAGTGG - Intergenic
992175565 5:74146081-74146103 AATTCTAAGGTGTTGGGGAGGGG + Intergenic
994184440 5:96802819-96802841 CCTTATAAGAAGATGGAGACTGG + Intronic
994901323 5:105774090-105774112 CATTCAAAGGAGATGGGAATGGG - Intergenic
998047754 5:139003102-139003124 CCATCTCAGGAGCTGGGGAAAGG + Intronic
998439704 5:142147730-142147752 TCTTCTAGGGAGATAGGGATAGG + Intronic
998513798 5:142735305-142735327 TCCCCTAAGGAGCTGGGGAGGGG - Intergenic
999082119 5:148854636-148854658 CTTTCAAAGGAAATGGGGAGTGG + Intergenic
999182459 5:149679745-149679767 CCTTCTGGGAAGAAGGGGAGAGG + Intergenic
999708366 5:154294334-154294356 TTTTTTAGGGAGATGGGGAGTGG - Intronic
1002322213 5:178382810-178382832 CCTGCCAAGGCGGTGGGGAGGGG - Intronic
1002534910 5:179870670-179870692 CCTTGTTAACAGATGGGGAGGGG + Intronic
1003126838 6:3362595-3362617 CTTGCTAAGGAGATGGGATGGGG - Intronic
1003403166 6:5807495-5807517 CAATGTAAGGACATGGGGAGGGG + Intergenic
1004933859 6:20488659-20488681 CCCCCCAATGAGATGGGGAGAGG + Intronic
1005937213 6:30532482-30532504 CCTTATAAAGAGATGAAGAGAGG - Intergenic
1006076079 6:31533334-31533356 GCTTCTAAGAACATGGGGTGGGG + Intronic
1007308117 6:40923083-40923105 CCATCTGAGTAGATGGAGAGTGG + Intergenic
1008777405 6:55057439-55057461 GCTGGTAAGGATATGGGGAGAGG - Intergenic
1012820008 6:104074542-104074564 CCTTCTAAGGAGCTGTAGAAAGG - Intergenic
1012979559 6:105815262-105815284 CATGCTAGGGAGGTGGGGAGGGG - Intergenic
1013024568 6:106258139-106258161 CCGTTTGAGGAGATGGGGAGTGG - Intronic
1013675532 6:112457370-112457392 ATTTCTAATGTGATGGGGAGGGG - Intergenic
1016714018 6:147203813-147203835 CCCTGTCAGGCGATGGGGAGCGG + Intergenic
1018172177 6:161151985-161152007 CCTTCTAAGAGGCTGGGCAGAGG + Intronic
1018475442 6:164135607-164135629 CTTTCTGGGGAGAAGGGGAGAGG + Intergenic
1018905812 6:168075335-168075357 CCTGCAAAAGAGGTGGGGAGGGG + Exonic
1019990470 7:4686845-4686867 CCTTCTTCGGTTATGGGGAGGGG + Intronic
1021086444 7:16425627-16425649 ACCTGTAGGGAGATGGGGAGTGG - Intergenic
1021235518 7:18138328-18138350 CCTTGCAAGGAGAGAGGGAGAGG - Intronic
1023098266 7:36685654-36685676 CCTTCTAGGGAGGTGGGGCAGGG + Intronic
1024560458 7:50640487-50640509 CCTTCTAAAGAGAAGGGTGGAGG - Intronic
1025709019 7:63890851-63890873 CCAGCTGGGGAGATGGGGAGAGG + Intergenic
1025852189 7:65252460-65252482 CCACCTAAGGAGGAGGGGAGGGG - Intergenic
1028240965 7:88420161-88420183 CTTTCTAGGGAGAAGGGGAAAGG + Intergenic
1028983200 7:96989685-96989707 CTTTCTAGGGAGTTGGGAAGGGG + Intergenic
1029413375 7:100429135-100429157 GCTTCTAAGAAGGTGGGCAGAGG + Intronic
1031079048 7:117240822-117240844 CCTTCTAAGCAGGTAGGGAGTGG - Intergenic
1031506637 7:122592830-122592852 CCTTCCAGGGGGATGGGGGGAGG + Intronic
1032076938 7:128840529-128840551 CCCTCTGAGGAGATGGGGGCAGG - Exonic
1032462938 7:132125448-132125470 ACTTCCAAGGGGATGAGGAGAGG - Exonic
1034041047 7:147876890-147876912 CCTTGTAAGGGAATGTGGAGAGG + Intronic
1035690722 8:1557736-1557758 CCCTATGAGGACATGGGGAGAGG - Intronic
1036560488 8:9897352-9897374 GCTCCTAGGGAGGTGGGGAGGGG + Intergenic
1037699513 8:21262075-21262097 CCTTCTAAGGAAACAAGGAGTGG + Intergenic
1037827799 8:22169734-22169756 CCTTCTGGGGAAGTGGGGAGAGG - Intronic
1040519167 8:48160383-48160405 CCTTTGAAGGAGGTGGTGAGTGG + Intergenic
1041084161 8:54241840-54241862 CCATCTAAAGCAATGGGGAGGGG + Intergenic
1041699688 8:60774482-60774504 CCTTCTAGGGCAATGGGAAGAGG - Intronic
1043261546 8:78205866-78205888 CCCTCTAAGGAGAAAGGGATAGG + Intergenic
1044580278 8:93819489-93819511 CCTTCTGAGGGGCTGGGGAGTGG - Intergenic
1045548449 8:103149313-103149335 CTTTCTATGGAGATGGAGATTGG - Intronic
1048888104 8:138924724-138924746 CATTCTAAGCACATGGGGTGGGG - Intergenic
1049045698 8:140149777-140149799 CCTTTCAAGGAGATGAGAAGGGG - Intronic
1053432473 9:38052204-38052226 GGGACTAAGGAGATGGGGAGGGG - Intronic
1053737665 9:41111722-41111744 CCTTATATAGAGAGGGGGAGGGG + Intergenic
1054690684 9:68319597-68319619 CCTTATATAGAGAGGGGGAGGGG - Intergenic
1055894285 9:81157682-81157704 CCTTCCCACAAGATGGGGAGTGG - Intergenic
1056101109 9:83301378-83301400 CCTTCCAAGAAGATGGGGAGAGG - Intronic
1056325257 9:85472727-85472749 CCTTCCAATAACATGGGGAGAGG + Intergenic
1056427412 9:86491039-86491061 CCTTCAAGGGAGCTGGGAAGAGG + Intergenic
1056452625 9:86730816-86730838 CTTTCTAAGCAGGTGGGGAAAGG - Intergenic
1056872104 9:90291351-90291373 CCTTCTCAGAAGATGGAGAAGGG - Intergenic
1057602775 9:96472992-96473014 CCTGCAAAGGAGATGCTGAGAGG - Intronic
1057607612 9:96511612-96511634 CCTTCTGGGGAGAAGGGGATGGG + Intronic
1058056916 9:100457917-100457939 CCTCCTAAGAAGGTGAGGAGAGG + Intronic
1058342844 9:103919965-103919987 CATTGTGAGTAGATGGGGAGGGG + Intergenic
1058521542 9:105817969-105817991 CCTTATATCGAGAGGGGGAGAGG + Intergenic
1060667985 9:125444395-125444417 CCTTCTATAGAGCTGCGGAGTGG + Intronic
1062432592 9:136532718-136532740 CCTCCTTAGGAGATGGGAAGCGG - Intronic
1189859527 X:45258524-45258546 CATTCCTGGGAGATGGGGAGAGG + Intergenic
1190760465 X:53433965-53433987 GCTTCTGAGGAGAAGGGGGGAGG + Intronic
1192322781 X:70105439-70105461 CTTTCCATGGAGATGGGAAGGGG + Intergenic
1193251014 X:79290647-79290669 CCTTTCAGGAAGATGGGGAGAGG + Intergenic
1196959953 X:120990587-120990609 CCTTTAAAGGAGATGGGGCTGGG + Intergenic
1199579898 X:149350715-149350737 ACTTCTAAGGACATGGGGCTAGG - Intergenic