ID: 1148214274

View in Genome Browser
Species Human (GRCh38)
Location 17:45825874-45825896
Sequence TCATTGCCACCAACCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148214265_1148214274 20 Left 1148214265 17:45825831-45825853 CCAGAATGGAGTGGGCACCAGTG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1148214274 17:45825874-45825896 TCATTGCCACCAACCCAGAGAGG 0: 1
1: 0
2: 2
3: 19
4: 150
1148214272_1148214274 3 Left 1148214272 17:45825848-45825870 CCAGTGGGGAGCTTGGAAGGGAG 0: 1
1: 0
2: 1
3: 27
4: 285
Right 1148214274 17:45825874-45825896 TCATTGCCACCAACCCAGAGAGG 0: 1
1: 0
2: 2
3: 19
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148214274 Original CRISPR TCATTGCCACCAACCCAGAG AGG Intronic
900748245 1:4376158-4376180 ACATTTCCAGCACCCCAGAGAGG - Intergenic
902239146 1:15076710-15076732 TCATTGCATCCTCCCCAGAGAGG - Intronic
903025358 1:20426323-20426345 TCATTTCCCCCACCCCAGAGAGG - Intergenic
904323133 1:29709534-29709556 TCATTCTCTCCAACCCAGAGAGG - Intergenic
905650246 1:39651535-39651557 TCATAACAAGCAACCCAGAGAGG + Intergenic
905744002 1:40398103-40398125 TCATTGCAAACAATTCAGAGAGG + Intronic
906123480 1:43411303-43411325 GCATTGCCAGCAGGCCAGAGGGG + Intronic
906683976 1:47750925-47750947 TCATTTCCTCCAACCTAGACTGG + Intergenic
908303441 1:62785121-62785143 TCATTGCCAAAAACCCACCGGGG - Intronic
911723850 1:101220483-101220505 TCAATGCCACCCACTCAGAGAGG + Intergenic
912347339 1:108976707-108976729 TCAATGCCACCTAGCCAGAGAGG - Intronic
918395520 1:184110292-184110314 TCTTTTCCAGCAACCCAGAGGGG - Intergenic
919061107 1:192633999-192634021 TAATTGGCAGCAAACCAGAGGGG + Intergenic
919799246 1:201343216-201343238 TCATTACCACCAACCTTAAGCGG - Intergenic
919861736 1:201743348-201743370 TAATTGCCACCCAACCAGTGGGG + Intronic
920524277 1:206655284-206655306 TCATTGTCATCAAGCAAGAGAGG - Intronic
923045291 1:230351033-230351055 TCATTGCCACGTGCACAGAGCGG - Exonic
924910090 1:248500643-248500665 TCACTGCCACCCACCCAGAGTGG - Intergenic
924914014 1:248547412-248547434 TCACTGCCACCCACCCAGAGTGG + Intergenic
1064709710 10:18110818-18110840 TCATTCCCACCAACACACAGAGG - Intergenic
1065886893 10:30086564-30086586 TAATTGCCACCCACCCTGGGTGG + Intronic
1067046933 10:42990252-42990274 TCATGGCCTCTAACTCAGAGGGG + Intergenic
1069569302 10:69484802-69484824 TCGTTGCCACTGAGCCAGAGGGG - Intronic
1069962933 10:72088920-72088942 CCCTTGCCTCCCACCCAGAGGGG + Intronic
1073449329 10:103600411-103600433 GCATTGCCAGCAGGCCAGAGGGG + Exonic
1073787703 10:106908505-106908527 TCATCCACACCAGCCCAGAGAGG - Intronic
1074436177 10:113436311-113436333 TCAGTGCCCCAAATCCAGAGTGG - Intergenic
1075376434 10:121981437-121981459 TCATTGCCTCAACCCCAAAGTGG + Intergenic
1079282396 11:19099115-19099137 TCATTGCCTACAACCCCGAGAGG + Intergenic
1080649081 11:34208848-34208870 TCACTGCCACCACCCCAGTCAGG + Intronic
1081907407 11:46678634-46678656 TCATTCCCAGCAATCAAGAGGGG + Exonic
1083363650 11:62128532-62128554 CCATTGCCACATACCCTGAGAGG - Intronic
1084601870 11:70150407-70150429 TCATTCCCACCTACCCTGAAGGG - Intronic
1085311695 11:75520755-75520777 TGTTTGCCACCACCCCAAAGGGG + Intronic
1086879622 11:92138146-92138168 CCATTGCCATCCACCCAGTGGGG + Intergenic
1086890757 11:92255224-92255246 TCACTGCTACAAACCCAGGGAGG - Intergenic
1088521335 11:110704038-110704060 TCATTGTCTTCAACACAGAGGGG + Intronic
1091625539 12:2118212-2118234 TCATTGCCTCCACCACAGTGGGG - Intronic
1092423671 12:8355911-8355933 TCATTCCCCACAAACCAGAGAGG + Intergenic
1094251397 12:28366543-28366565 TCATTAACACCACCCCAGTGAGG - Intronic
1096795348 12:54073805-54073827 TCCTTGACCCCAACCCAGAGTGG - Intergenic
1098215893 12:68218250-68218272 CAATTGAAACCAACCCAGAGTGG + Intronic
1102820112 12:115901428-115901450 TCAATGCCACCTCCTCAGAGAGG - Intergenic
1105595607 13:21834844-21834866 TGATTTCCACCAAAGCAGAGAGG - Intergenic
1109569427 13:64166862-64166884 TCATTGCTAGTAACCCAGACTGG + Intergenic
1111018446 13:82412864-82412886 TTATTGTCACCAACACGGAGAGG - Intergenic
1111261432 13:85745707-85745729 TCATGGCATCCAACACAGAGAGG - Intergenic
1112176504 13:97030647-97030669 TCAGTAACACAAACCCAGAGTGG - Intergenic
1115766100 14:36625062-36625084 TCCTTGCCTCCACTCCAGAGAGG - Intergenic
1116065178 14:39972990-39973012 TCATTACCACCACCCCAGAAAGG - Intergenic
1119331324 14:73796199-73796221 TCTTTGCAACCAACTCAGATGGG - Intergenic
1120657943 14:87217959-87217981 AAGTTGCCCCCAACCCAGAGAGG + Intergenic
1122977550 14:105177124-105177146 TCCTTGCCAGCAGCCCAGGGAGG + Intronic
1124070789 15:26391361-26391383 TCATTGCCTCCACTCCACAGGGG + Intergenic
1124204775 15:27707812-27707834 GCATGGCCACCAGCCCAGCGTGG + Intergenic
1124916962 15:33985290-33985312 TCATTGCCCCCGTCTCAGAGTGG + Intronic
1126561491 15:50048844-50048866 TCATTGCTGCCACCCCAGAAAGG - Intronic
1128863442 15:71093834-71093856 TCATTTCCACCAGCACTGAGAGG + Intergenic
1129698409 15:77753849-77753871 GCATTGCCACTCACCCAAAGAGG + Intronic
1132087228 15:98918296-98918318 TCACTGCCCCCGACCCTGAGAGG + Intronic
1133239135 16:4404295-4404317 TCATTCCCAGCAACCCCGACAGG + Intronic
1136103363 16:28011319-28011341 TCACAGCCCCCAACCCAGGGCGG - Intronic
1139515285 16:67449128-67449150 TCAGTGCCACCAGCCTGGAGTGG - Intronic
1139959472 16:70709485-70709507 TCAGTGCCATCCACCCACAGAGG - Intronic
1140602548 16:76494916-76494938 TCCTACCCACCAACTCAGAGGGG - Exonic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141975513 16:87513396-87513418 GCAGTGCCACCAAGCCTGAGGGG - Intergenic
1143687365 17:8528779-8528801 TCAAGACCACCACCCCAGAGAGG - Intronic
1144100036 17:11934888-11934910 TCATAGCCACCAACACGGAGTGG - Intronic
1145226282 17:21130929-21130951 TTCTTGCCACCCACCCAGATAGG + Intronic
1146396369 17:32470907-32470929 TGATTCCCACAAACCCAAAGTGG + Intronic
1147733418 17:42618444-42618466 CTACAGCCACCAACCCAGAGGGG + Intergenic
1148214274 17:45825874-45825896 TCATTGCCACCAACCCAGAGAGG + Intronic
1148457949 17:47821035-47821057 GAAGTGCCACCCACCCAGAGAGG + Intronic
1148934719 17:51155677-51155699 TCATTGCGATCAAACCAGATGGG + Exonic
1149585545 17:57783598-57783620 GAACTGCCCCCAACCCAGAGGGG - Intergenic
1150437798 17:65167625-65167647 TCCTTGTCACCATCCCACAGGGG + Intronic
1156408718 18:36807490-36807512 TCACTGCCGCCTACCCTGAGGGG + Intronic
1157574971 18:48737453-48737475 TCTTTGCCCCTTACCCAGAGTGG + Intronic
1158450080 18:57556497-57556519 TCATTGGCAAGAACCCACAGGGG - Intronic
1159584694 18:70272572-70272594 TCATTACCACCACCCCAGGAAGG + Intergenic
1161109000 19:2458460-2458482 TCACAGCCACCAAGCCAAAGGGG - Intergenic
1161769833 19:6225192-6225214 TCACAGCCACCACCCAAGAGTGG - Intronic
1162746277 19:12800437-12800459 TCCTTGCACCCAACCCAGGGTGG - Intronic
1162785867 19:13034352-13034374 TCCCTGCCACCAACCTCGAGAGG + Intronic
1162999314 19:14356184-14356206 TCATTTCCACCCATCTAGAGAGG - Intergenic
1163064817 19:14785168-14785190 TCATTTCCACCCATCTAGAGAGG + Intergenic
1163457874 19:17419337-17419359 TCTTTGCCACCTACACAAAGTGG + Exonic
1166970608 19:46564783-46564805 ACACTGACACCAAACCAGAGGGG - Intronic
1168079846 19:54001663-54001685 TCAATGTCACCTCCCCAGAGAGG - Intronic
925664584 2:6239008-6239030 TCATTGCCACCCATGCAGAAGGG + Intergenic
926259132 2:11240647-11240669 GCATTTCCACCATCCCAAAGTGG - Intronic
926705316 2:15833443-15833465 TGATGACCACCAACCCAGATGGG - Intergenic
927712800 2:25336202-25336224 ACCGAGCCACCAACCCAGAGGGG - Intronic
928008433 2:27583819-27583841 TCATAGCCACTAACCCGGTGTGG + Intronic
929578364 2:43066813-43066835 CCAGTGTCACCAACCCAGATAGG + Intergenic
931289741 2:60862019-60862041 GCAGGGGCACCAACCCAGAGAGG - Intergenic
931494895 2:62794191-62794213 TCATGTCCACCAACACAGAGTGG - Intronic
932309618 2:70729111-70729133 TAATTGCCCCCAACCCAGCATGG - Intronic
934551811 2:95267432-95267454 TCTTTGCAGCCCACCCAGAGAGG + Intergenic
937000407 2:118460775-118460797 TCATTGCTATAAACCCAGCGTGG + Intergenic
937886803 2:126905456-126905478 TCATTGACAGCATTCCAGAGTGG + Intergenic
939826075 2:147017003-147017025 TCATTGCCACCAACTCACAACGG + Intergenic
940249968 2:151664391-151664413 GCATTCCCACCAACCCTGAATGG + Intronic
943148107 2:184071792-184071814 TTATTGGCACCAACCCACAGTGG + Intergenic
945698079 2:213134253-213134275 TCATTGCCATCTCCCAAGAGGGG + Intronic
946304434 2:218847654-218847676 TAATTGCTACTAGCCCAGAGAGG + Intergenic
948696576 2:239735967-239735989 ACTTGGCCACCAGCCCAGAGGGG - Intergenic
948898788 2:240945420-240945442 TCAGAGCCACCAAAACAGAGAGG - Intronic
1168792592 20:589695-589717 TCTTTGCCACCAAAAGAGAGAGG + Intergenic
1169017467 20:2303642-2303664 CCATGGCCACCGAGCCAGAGTGG + Intronic
1171325943 20:24292921-24292943 TCATTCCAACCAACCCGCAGGGG + Intergenic
1173407193 20:42776973-42776995 TCACTCCCACAAACCCAGAATGG + Intronic
1174814887 20:53678137-53678159 TGATTGCCACCAACCTACAGTGG - Intergenic
1175341704 20:58235077-58235099 ACATTGGGACCAACCCAGTGTGG - Intergenic
1175374673 20:58515799-58515821 GTGTTGCCACGAACCCAGAGAGG + Intergenic
1179573889 21:42294746-42294768 TCTTGGCCAGCAGCCCAGAGTGG - Intronic
1180795682 22:18603810-18603832 TCATTCCCGCCCTCCCAGAGGGG + Intergenic
1181226047 22:21391462-21391484 TCATTCCCGCCCTCCCAGAGGGG - Intergenic
1181252589 22:21543350-21543372 TCATTCCCGCCCTCCCAGAGGGG + Intergenic
1182263348 22:29092358-29092380 AACTTGCCACCAACCCAGAGAGG - Intronic
1183984198 22:41560635-41560657 TCATGCCCACCCACCCCGAGGGG + Intergenic
952344913 3:32474172-32474194 TCCATGCCACCTACCCACAGAGG + Intronic
954083124 3:48224105-48224127 CCCTTGCCCCCACCCCAGAGTGG + Intronic
963300701 3:143593995-143594017 CCATTGCCACCAACACAGACTGG - Intronic
970878226 4:20897375-20897397 CCCTTGCCACCAACTCAGTGAGG + Intronic
972381578 4:38524789-38524811 TCTTTGCCCCCAACACAGGGTGG - Intergenic
976189389 4:82474230-82474252 CCAATGCCCCCAACCCAGAAGGG - Intergenic
976288571 4:83394050-83394072 TCAAAGCCACCAACTCAGCGGGG + Intergenic
983469757 4:168141976-168141998 TCATTACCACCACCCCAGTAAGG + Intronic
983796932 4:171875549-171875571 TCATTACCACCACCCCAGGAAGG + Intronic
986711095 5:10488400-10488422 GGATTGCCAGCAACCCACAGAGG + Intergenic
986735338 5:10663682-10663704 TCATTGCCAGAGACGCAGAGGGG - Intergenic
988483504 5:31649018-31649040 TCCTGCCCCCCAACCCAGAGGGG + Intronic
989212317 5:38868184-38868206 CCATTGCCACCAACCATCAGTGG + Intronic
993979047 5:94520814-94520836 TCATTCCCATCAACCCTAAGTGG - Exonic
995063592 5:107837392-107837414 TCACTGCCATCAACACAGACAGG + Intergenic
998767727 5:145506842-145506864 TCAATGCCACCTCCTCAGAGAGG + Intronic
998879946 5:146635595-146635617 TCTGGGCCACCAACCCAGGGTGG - Intronic
1000347787 5:160329292-160329314 TCACAGCAACCAACCCAAAGGGG + Intronic
1002072647 5:176689515-176689537 TAATTGCCACCTTCTCAGAGAGG + Intergenic
1002643885 5:180643638-180643660 TCCTTGCCACCCACCCGGTGCGG + Intronic
1005959588 6:30685998-30686020 CCATGGCCACCATCCCAGACTGG - Exonic
1007415808 6:41690666-41690688 ACATTGGCTCCAACCCTGAGAGG - Exonic
1007427043 6:41753920-41753942 TCCTTTCCACCAACCCAGAAAGG - Intronic
1008518950 6:52344722-52344744 TGATTGCCACCAACACATTGGGG - Intergenic
1008619488 6:53258020-53258042 TAAATGCCACCTTCCCAGAGAGG - Intergenic
1009300568 6:62012725-62012747 TCATTGCCACTATCTCAGAGAGG + Intronic
1009886069 6:69625667-69625689 TCATTACCACCAACTCAGGAAGG + Intergenic
1012935564 6:105363982-105364004 TCATTGCAAGCAGCCAAGAGAGG + Intronic
1019322613 7:422506-422528 TTCTTGCCACCTGCCCAGAGGGG + Intergenic
1022883930 7:34622215-34622237 CCAGTGCCACCATCCCTGAGAGG + Intergenic
1027051055 7:75021515-75021537 ACTTTGCCACCACCCCACAGTGG - Intronic
1030625617 7:111842685-111842707 TCTTTGACACCACCCCAGTGGGG - Intronic
1033660690 7:143399804-143399826 CCACTTCCACCAACCCAGCGGGG + Exonic
1033824687 7:145174978-145175000 TCAATGCCACCTTCTCAGAGAGG + Intergenic
1035110891 7:156480857-156480879 TCATGGCCACCAACGCCGTGGGG - Intergenic
1036696010 8:10975609-10975631 CCATTTCCTCCAGCCCAGAGAGG - Intronic
1038286902 8:26213324-26213346 TGATTGCCACCAAACTAGATAGG + Intergenic
1038893086 8:31749655-31749677 TCTTTGCTTCCAACACAGAGAGG - Intronic
1040568236 8:48585844-48585866 TCATTGGAACTAACCCACAGAGG - Intergenic
1045998612 8:108393299-108393321 TCATGGCCATCAGCCCTGAGAGG + Intronic
1049794448 8:144490146-144490168 CCCCTGCCACCAACCCACAGCGG - Exonic
1057201412 9:93142349-93142371 TCACTGGGACCAGCCCAGAGGGG + Intergenic
1061789417 9:133051278-133051300 TCATTGCAGCCAAGCCAGTGGGG + Intronic
1061844567 9:133379794-133379816 TCCCTGCCACCACCACAGAGAGG - Intronic
1191585892 X:62826501-62826523 TCTTTGACACCACCCCAGAGAGG + Intergenic
1192038641 X:67593306-67593328 TTACTGACACCAACCCAAAGCGG - Intronic
1195392990 X:104382512-104382534 TGCTTTGCACCAACCCAGAGAGG + Intergenic
1200079583 X:153569399-153569421 TCTGTGCCACCCACCGAGAGAGG - Intronic
1201862634 Y:18616019-18616041 ACATTGCCACCTACTGAGAGTGG + Intergenic
1201870689 Y:18704361-18704383 ACATTGCCACCTACTGAGAGTGG - Intergenic