ID: 1148214544

View in Genome Browser
Species Human (GRCh38)
Location 17:45827276-45827298
Sequence CCCTTCAGTGCTGCCTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148214544_1148214556 27 Left 1148214544 17:45827276-45827298 CCCTGGAAGGCAGCACTGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 336
Right 1148214556 17:45827326-45827348 CCAGCCTGGGCCTGTGAACAAGG 0: 1
1: 0
2: 2
3: 26
4: 490
1148214544_1148214550 14 Left 1148214544 17:45827276-45827298 CCCTGGAAGGCAGCACTGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 336
Right 1148214550 17:45827313-45827335 GCGCTCCTCCCGCCCAGCCTGGG 0: 1
1: 0
2: 4
3: 27
4: 386
1148214544_1148214549 13 Left 1148214544 17:45827276-45827298 CCCTGGAAGGCAGCACTGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 336
Right 1148214549 17:45827312-45827334 TGCGCTCCTCCCGCCCAGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148214544 Original CRISPR CCCTTCAGTGCTGCCTTCCA GGG (reversed) Intronic