ID: 1148214544

View in Genome Browser
Species Human (GRCh38)
Location 17:45827276-45827298
Sequence CCCTTCAGTGCTGCCTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148214544_1148214550 14 Left 1148214544 17:45827276-45827298 CCCTGGAAGGCAGCACTGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 336
Right 1148214550 17:45827313-45827335 GCGCTCCTCCCGCCCAGCCTGGG 0: 1
1: 0
2: 4
3: 27
4: 386
1148214544_1148214549 13 Left 1148214544 17:45827276-45827298 CCCTGGAAGGCAGCACTGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 336
Right 1148214549 17:45827312-45827334 TGCGCTCCTCCCGCCCAGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 458
1148214544_1148214556 27 Left 1148214544 17:45827276-45827298 CCCTGGAAGGCAGCACTGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 336
Right 1148214556 17:45827326-45827348 CCAGCCTGGGCCTGTGAACAAGG 0: 1
1: 0
2: 2
3: 26
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148214544 Original CRISPR CCCTTCAGTGCTGCCTTCCA GGG (reversed) Intronic
900251924 1:1675377-1675399 CCCGTCTCTGCTGCCTGCCATGG - Intronic
900262335 1:1738234-1738256 CCCGTCTCTGCTGCCTGCCATGG - Intronic
900393134 1:2442510-2442532 CCCGTCAGCTCTGCCTGCCAGGG - Intronic
901214504 1:7548382-7548404 CCCTTAAGGGGTGCCCTCCATGG - Intronic
901880798 1:12192682-12192704 CCACCCAGTCCTGCCTTCCAGGG - Intronic
902513652 1:16979042-16979064 CCCTTCAGTGCTGCCTTTCTGGG - Intronic
903827574 1:26156785-26156807 CCCTTCACAGCTCCCTTCTAGGG - Intergenic
903910100 1:26717805-26717827 CACTTCAGTGTGGCCTTCCCTGG - Intronic
905400764 1:37701390-37701412 CCCTGCAGTGCTCCCTTCCTGGG - Intronic
905650888 1:39656223-39656245 CACCTCAGTGCTGCATTCCCTGG + Intergenic
907011867 1:50969853-50969875 CCCTGCAGTTCTGCCTCACACGG + Exonic
907391023 1:54158327-54158349 CCCTGCTGTGCTGACTCCCATGG + Intronic
907597405 1:55732587-55732609 CCCTTCACTGCTGCCCTTCAGGG - Intergenic
907780405 1:57561296-57561318 CCCTTCACTGCTGTCCTTCAGGG - Intronic
907812047 1:57880504-57880526 CTCCTCAGTGAAGCCTTCCATGG + Intronic
907830450 1:58059961-58059983 CCCTTTTGTGCTGCCTTCCCGGG - Intronic
907956771 1:59236031-59236053 CCCTTCAGTCCTGTCTGCAAGGG - Intergenic
908282901 1:62561117-62561139 CCCCTCAGAGAGGCCTTCCATGG - Intronic
909548884 1:76876723-76876745 CCCTTCACTGCTGTCCTTCAGGG + Intronic
910370697 1:86512591-86512613 CCCTTCATTGCTGTCTTTCAAGG - Intergenic
911179505 1:94848395-94848417 CCCTACAGTGCTGCTGCCCAGGG - Intronic
911490658 1:98562232-98562254 TCTTTCATTGCTGCCATCCATGG + Intergenic
911745011 1:101432100-101432122 ATCTTCAGTGCTGCTTTCAAAGG - Intergenic
912477398 1:109947936-109947958 CCTTTCAGTCCTGCCTGCCTGGG + Intergenic
912720800 1:112018483-112018505 CACTCCAGTGCTGGCTTCCTGGG + Intergenic
913111433 1:115660871-115660893 GCCTTTAGTGCTGCCTGCCTTGG + Intronic
914885151 1:151578583-151578605 CTCTTCAGAGCAGCCTACCAGGG + Intronic
915298398 1:154937894-154937916 CCACTCTGTGCTGCCTTCTAGGG - Intergenic
915374206 1:155377896-155377918 GCCTGCAGTGCTGGCTACCAGGG + Intronic
917462764 1:175246617-175246639 CCCTTCATTGCTGTCCTTCAGGG - Intergenic
917989870 1:180363590-180363612 CCTTTCAGTCCTCCCTCCCAAGG - Intronic
919241833 1:194924663-194924685 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
919528878 1:198690638-198690660 TCCTTCAGAGTTGCCATCCAAGG - Intronic
919879368 1:201891870-201891892 CCCTTCAGTGATGCCAACCTTGG + Exonic
920372881 1:205490706-205490728 CTCTGCAGGGCTGGCTTCCATGG - Intergenic
921913195 1:220575126-220575148 CTCTTCAGTGCTGCATCCCATGG - Intronic
1063327263 10:5116732-5116754 CCCTTCATTGCTGTCCTTCAGGG + Intronic
1067068076 10:43114771-43114793 CCCTCCCCAGCTGCCTTCCAGGG + Intronic
1067141861 10:43664652-43664674 CCCATTAGTGGTGCCTACCATGG + Intergenic
1067174304 10:43931678-43931700 CCCTCCTGTGCTGCCATTCAAGG - Intergenic
1067772054 10:49133742-49133764 CCCATCAGGGCTTCCTTCCCAGG + Intronic
1068177265 10:53477509-53477531 TCCTTGAGTGATGCCTCCCAAGG + Intergenic
1068513810 10:58000876-58000898 CCCTCCAGTGCTGTGTCCCATGG - Intergenic
1070846040 10:79523576-79523598 CTCTCCAGTGCTGACCTCCAGGG + Intergenic
1071267018 10:83973544-83973566 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
1071378438 10:85033819-85033841 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1071793560 10:88981659-88981681 CCCTACAGTGTTCCCTTCCCAGG - Intronic
1071977153 10:90966554-90966576 CCCTTCCCTACTGCCTTCCTTGG + Intergenic
1072810506 10:98457791-98457813 CCCTTCTGGGCAGCCTTGCAGGG + Intronic
1074329329 10:112488804-112488826 CCCAACAGTGCTTCCTTTCATGG - Intronic
1074536228 10:114330206-114330228 CCCTTCATTCGTGCCTTCCTGGG - Intronic
1075606849 10:123817860-123817882 CCCTTCAGTGCTGTCCTTCAGGG - Intronic
1076125096 10:127967798-127967820 CCCTTCATGCCTCCCTTCCAGGG + Intronic
1076449476 10:130546875-130546897 TCCTTCAGTGACACCTTCCAGGG + Intergenic
1077344078 11:2038427-2038449 TCCTGCCGTGCAGCCTTCCATGG - Intergenic
1078515386 11:12017546-12017568 CCCTCCTGTGCTGCGTTTCAAGG - Intergenic
1079130038 11:17741899-17741921 CTCCTCAGTGATGCCTTCCCGGG + Intronic
1081609122 11:44548314-44548336 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1081787371 11:45756914-45756936 CTCTTAAAAGCTGCCTTCCAGGG - Intergenic
1081810271 11:45910430-45910452 CCCTGCAGTGCTGCCTCCTGGGG - Intronic
1081815746 11:45939875-45939897 CCCTTCAGTCTTCCCTTCCCTGG - Intronic
1082720889 11:56675016-56675038 CCCTTCTGTGTTGCCTGTCATGG + Intergenic
1083209467 11:61174084-61174106 CTCCTCAGTGATGCCTTCCATGG - Intergenic
1083626025 11:64072357-64072379 TCCTGCATTGCTGGCTTCCACGG - Intronic
1083961016 11:66015175-66015197 CACTGCAGTGCTGCCTGCCTGGG - Intergenic
1084025594 11:66446811-66446833 ACCTTCAGAGCTGCATTCCCAGG - Intronic
1084351515 11:68603357-68603379 TCCGTCAGAGCTGGCTTCCATGG - Exonic
1085202275 11:74708861-74708883 CCCTGCAGTCTTGCCTTTCAAGG - Intronic
1085560239 11:77465871-77465893 CACTGCAGTGCTGCCCTCCCGGG - Intronic
1085637054 11:78167075-78167097 TCCTTGAGTGCTGTCTCCCAAGG - Intergenic
1086293275 11:85336013-85336035 CCCTTCAGTGAAACCTTACAAGG - Intronic
1086865070 11:91970833-91970855 CTTTTCAGTGATGCCTTCCAAGG - Intergenic
1087712269 11:101567457-101567479 CTCTTCAGAGCTGCCTGGCAGGG - Intronic
1088097269 11:106115593-106115615 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1088836723 11:113583825-113583847 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1089284742 11:117398318-117398340 CCCTTCCCAGCTGCCTTCCGAGG + Intronic
1089527783 11:119108123-119108145 CCCTTCAGCCTTTCCTTCCAGGG + Exonic
1089646955 11:119886733-119886755 TCCTGCAGGGCTGCCATCCATGG + Intergenic
1089781415 11:120875621-120875643 CCCTTCAGTGTTGCAGTGCATGG + Intronic
1089916555 11:122162615-122162637 GCCTTCAGTGCTGCCATCTTGGG + Intergenic
1090393305 11:126403378-126403400 TCCTCCAGGGCTGCCTTCCAGGG - Intronic
1090593133 11:128293388-128293410 CCATTCAGTGGTGATTTCCAGGG - Intergenic
1090753936 11:129772165-129772187 CCCTTCACAGCTGTCTTTCAGGG + Intergenic
1202827064 11_KI270721v1_random:93616-93638 TCCTGCCGTGCAGCCTTCCATGG - Intergenic
1091786027 12:3243928-3243950 CCCTTTAGTTCTGCATTCCTGGG + Intronic
1092106374 12:5924495-5924517 CCCTTCTGTGCTGTCTCCCTAGG - Intronic
1092284932 12:7123192-7123214 CCCTTCTGGGCTGTTTTCCAAGG + Intergenic
1095844329 12:46729538-46729560 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
1096053341 12:48630288-48630310 TTTTTCTGTGCTGCCTTCCAAGG + Intergenic
1096457401 12:51799000-51799022 CCCTTCAGTGCTCTCCTTCAGGG + Intronic
1099508623 12:83507624-83507646 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1099556528 12:84115138-84115160 TCCTTCAGTGCTGTCTGCAAGGG + Intergenic
1100004556 12:89878823-89878845 CACTTCAGTGCTTCCTTCCCAGG - Intergenic
1103614723 12:122145000-122145022 CACTGCACTGCTGCCTTCCATGG + Exonic
1103938112 12:124487069-124487091 ACCTTCAGTCCTGTCTTCCCAGG - Intronic
1105206867 13:18232845-18232867 CCGTCCAGGGCTGCCGTCCAGGG + Intergenic
1105740178 13:23315617-23315639 CCCTTCACTGCTGTCCTTCAGGG - Intronic
1107614614 13:42152614-42152636 CCCTTCTGCCCTGCCTTCCATGG - Intronic
1109950963 13:69501771-69501793 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
1112086645 13:96039148-96039170 ACCCTCTGTGCTGCCTGCCATGG + Intronic
1112226783 13:97547303-97547325 TCCCTCAGAGCAGCCTTCCATGG + Intergenic
1112231068 13:97589729-97589751 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
1115059772 14:29174330-29174352 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1117172820 14:53117773-53117795 CCCTTCAGAGCTGTCAGCCAGGG - Intronic
1118122379 14:62859733-62859755 CCCTTCACTGCTGTCCTTCAGGG + Intronic
1118444253 14:65837426-65837448 CCCTCCAGTTCTCCCCTCCAAGG - Intergenic
1119767371 14:77198827-77198849 CCCTTTACTGCTGGCTTCCTGGG - Intronic
1122409805 14:101520084-101520106 CCTTCCAGTGCTGCCGTCCCAGG - Intergenic
1123028350 14:105439118-105439140 CCCTGCAGGGCTGGCTGCCAGGG - Intronic
1123927684 15:25134349-25134371 CCTTTCTGTGCAGGCTTCCAGGG + Intergenic
1124689804 15:31812331-31812353 CCCTTCAGCTACGCCTTCCAAGG + Intronic
1128745402 15:70110823-70110845 CCCTTCAGAGCTGCCTCAAAAGG - Intergenic
1129744337 15:78007752-78007774 CCCTTCATTGCTCCCCTGCAGGG - Intronic
1130395858 15:83500677-83500699 CCCTTCCTTTCTCCCTTCCAGGG + Intronic
1131490183 15:92855932-92855954 CCCTGCAGTCCTGCCTACCAAGG + Intergenic
1132334527 15:101037505-101037527 CACTTCACTCCTGCCTACCATGG - Intronic
1132800657 16:1751074-1751096 CCCGTCAGTGCTGCCACCCACGG - Intronic
1135635041 16:24068328-24068350 CCCTCAAGTCCTGCCTTCCCTGG + Intronic
1135734698 16:24921360-24921382 TCCCTCACTGCTGCCTGCCATGG - Intronic
1136251003 16:29005025-29005047 CCCTTCACCGCTGTCCTCCAAGG - Intergenic
1137272932 16:46914704-46914726 CTGTTGAGTGCTGTCTTCCAGGG + Intronic
1137901730 16:52275997-52276019 CCCTTCAGTGCACCATTCAAGGG + Intergenic
1139674118 16:68511241-68511263 TCCATCTGTGCTCCCTTCCAAGG + Intergenic
1143189825 17:5033273-5033295 CCCTGCAGTGGTGCCCACCAGGG + Exonic
1143702999 17:8675368-8675390 CGCTTCAGTGCCCCCTTCCTGGG - Intergenic
1147626514 17:41904111-41904133 CCCTTCCTTTCTTCCTTCCATGG - Intronic
1148214544 17:45827276-45827298 CCCTTCAGTGCTGCCTTCCAGGG - Intronic
1149568235 17:57654183-57654205 CCCTGCAGTGCTGCCGGGCAGGG + Intronic
1149601886 17:57898709-57898731 CCCTTCAGGGCTGGATTCCCAGG - Intronic
1152799034 17:82322615-82322637 CCCTGCCATGCTGCCCTCCAGGG + Intronic
1153616285 18:6937696-6937718 CCCTGCAGTGCTGACTGCCCTGG - Intergenic
1154252614 18:12756841-12756863 CCCTTCACTGCTGTCCTTCAAGG + Intergenic
1156123599 18:33875675-33875697 CCCTTCCCTCCTGCCATCCAAGG + Intronic
1156990246 18:43400342-43400364 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
1157066494 18:44356735-44356757 CCCTTCAGAGCTGCCAGGCAAGG + Intergenic
1157426565 18:47589178-47589200 TCCAGCAGTGCTGCTTTCCAAGG - Intergenic
1159726571 18:71967817-71967839 CCCTGGAGTTCTGCCTTCCCTGG - Intergenic
1159912448 18:74159155-74159177 CACTTCATGGCTGCCTTCTATGG - Exonic
1160718222 19:585932-585954 TCCTTCAGCTCTGCCCTCCACGG - Intergenic
1160912887 19:1482996-1483018 GCCTTCAGTGCTGACGTCCAAGG + Exonic
1161399919 19:4062689-4062711 ACCCTCAGAGCTGCCTTGCAAGG + Intronic
1161512498 19:4679404-4679426 CCCTTCACTGCTGCCTCCTCAGG + Intronic
1161747906 19:6072775-6072797 CTCTTCAGTGCTGCCTACGGAGG + Intronic
1163035047 19:14565181-14565203 TCCTTCTGTCCTGCCTGCCAGGG + Exonic
1163104809 19:15117066-15117088 CCCTTCCGGCCTGCCGTCCATGG + Intronic
1163310766 19:16513199-16513221 CCCTTGCATGCTGGCTTCCAGGG + Intronic
1164587214 19:29483568-29483590 CCCCTCAGTGCAGTGTTCCAGGG + Intergenic
1165355675 19:35302453-35302475 CCGTTCACTGTTGGCTTCCAGGG - Exonic
1165845891 19:38817333-38817355 CCCGTGATTGCTGCCGTCCATGG - Exonic
1167527783 19:49995711-49995733 CCCATCAGGACTGCCTTCCCTGG - Intronic
1167616209 19:50535679-50535701 CCCTGCAGTGCTGCCAGTCATGG - Intronic
1167793334 19:51693698-51693720 GCCTTCACGGCCGCCTTCCAGGG + Intergenic
1168459263 19:56539617-56539639 TCTTTCAGCTCTGCCTTCCAGGG + Exonic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
925874297 2:8298775-8298797 CCCCTCACTGCTGTCTCCCAGGG + Intergenic
925923031 2:8650678-8650700 CCCTTCATGGATCCCTTCCACGG - Intergenic
926045653 2:9707902-9707924 CCCGTCAGTGCTGCCTTCTGTGG + Intergenic
926826825 2:16914101-16914123 ACCTTCAGTGCTGTCCTTCAGGG - Intergenic
927149646 2:20188300-20188322 CTCTTCAGTGCCTCCCTCCAGGG + Intergenic
927213411 2:20652281-20652303 CTCTTCACTGCAGCCTTCAAGGG - Intergenic
928682547 2:33717183-33717205 CCCCTCAGTGCTCATTTCCAGGG + Intergenic
929618442 2:43330751-43330773 CTCTTAGGAGCTGCCTTCCATGG - Intronic
930135959 2:47905115-47905137 CCCTTTTCTGCCGCCTTCCATGG - Intronic
930235994 2:48889474-48889496 CCCTTCCATGCAGCCTTCCTTGG - Intergenic
930910203 2:56621303-56621325 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
931101625 2:59008381-59008403 CCCATCAGTACTGACTCCCAAGG - Intergenic
931460737 2:62448234-62448256 CCCACCAGTGCTGCATTCCAAGG + Intergenic
933280032 2:80322929-80322951 CCCTTCAGTGATGCCTGGAATGG - Intronic
933743468 2:85553070-85553092 CCCCTCTGTGCTGCCTTCCCAGG - Exonic
934817205 2:97337983-97338005 CCCTTCTGTGCTGCCTAGGATGG - Intergenic
934820491 2:97370501-97370523 CCCTTCTGTGCTGCCTAGGATGG + Intergenic
935083248 2:99819972-99819994 CTGTGCTGTGCTGCCTTCCATGG - Intronic
936087780 2:109480977-109480999 CTCTTCAGTTCTCCCTTCCATGG - Intronic
936271757 2:111054513-111054535 CCCATCAGTGGAGCCTTCCTGGG - Intronic
937193939 2:120133336-120133358 CTCTTCAGTGCCTCCTTCCTTGG - Intronic
937239691 2:120452110-120452132 CCCTTCTGTGCTGCCTTGCCAGG - Intergenic
937582001 2:123498715-123498737 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
937852509 2:126648303-126648325 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
939671132 2:145014067-145014089 CCCCTCATTACAGCCTTCCATGG + Intergenic
940429847 2:153576343-153576365 TCCTTCTGTACTGCCTTTCAAGG + Intergenic
941160098 2:162026017-162026039 TTCTTCTGTGCTGCATTCCACGG - Intronic
943384010 2:187180658-187180680 CCCTTCACTGCTGTCATTCAGGG + Intergenic
943660542 2:190554749-190554771 CTCTTCAGTGCTGCCAGGCAGGG - Intergenic
944562084 2:200949933-200949955 CCCTTTAGTCCTCCCTTCCCAGG - Intronic
946527809 2:220539537-220539559 CCCTTCAATGCTGTCCTTCAGGG + Intergenic
948469296 2:238167025-238167047 CACTTCAGTGCTGTCCTCCTGGG + Exonic
948852847 2:240716825-240716847 CTCCTCACTGCGGCCTTCCAAGG + Exonic
1169060710 20:2658684-2658706 CCCTTCAGTGCAGTGTACCAGGG - Exonic
1169197216 20:3689743-3689765 GCCCCCAGTGCTTCCTTCCAAGG + Intronic
1172847539 20:37938783-37938805 CCCTTCAGCCCAGCCCTCCAGGG - Intronic
1174292728 20:49520264-49520286 CCTTTCAGTGAGGCCTTCCTGGG + Intronic
1174956722 20:55106053-55106075 CCCATGCATGCTGCCTTCCAGGG - Intergenic
1175278786 20:57788814-57788836 CCCTTCTGTCCTTCCTTCCAGGG - Intergenic
1175986129 20:62764946-62764968 CCCTCGACTGCTGCCCTCCACGG + Intergenic
1176257404 20:64159496-64159518 CCCCTCAGTGCTGCCCTGGATGG + Intronic
1177653605 21:23987874-23987896 CTCTTGACTGCTGCCATCCATGG + Intergenic
1177913240 21:27056645-27056667 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1179415092 21:41192104-41192126 CCCTTCACTGCTGTCCTTCATGG + Intronic
1179608285 21:42532518-42532540 CCTTTCCCTGCTGCCTCCCATGG - Intronic
1179615459 21:42580398-42580420 CCCTTCACAACTGCCTTTCAAGG + Exonic
1179987547 21:44930034-44930056 CCTGGCGGTGCTGCCTTCCATGG - Intronic
1180824648 22:18854150-18854172 GCCTTCTGAGCTGCCTTCCAAGG + Intronic
1181068266 22:20316690-20316712 ACCCTCAGTGCTGCCCTTCAGGG + Intronic
1181125071 22:20697306-20697328 GCCTTCTGAGCTGCTTTCCAAGG + Intergenic
1181188084 22:21120397-21120419 GCCTTCTGAGCTGCCTTCCAAGG - Intergenic
1181211114 22:21290096-21290118 GCCTTCTGAGCTGCCTTCCAAGG + Intergenic
1181398386 22:22636792-22636814 GCCTTCTGAGCTGCTTTCCAAGG - Intergenic
1181473378 22:23154209-23154231 CCCTTCCGTGCTCCCCTACATGG + Intronic
1181501127 22:23316150-23316172 GCCTTCTGAGCTGCCTTCCAAGG - Exonic
1181651028 22:24259268-24259290 GCCTTCTGAGCTGCCTTCCAAGG + Intergenic
1181706354 22:24651471-24651493 GCCTTCTGAGCTGCCTTCCAAGG - Intergenic
1181775299 22:25154833-25154855 CCCTGCAGAGCAGCCTTGCATGG - Intronic
1181880428 22:25975082-25975104 TCCATCAGTTCTGCCTTCCCAGG - Intronic
1183227278 22:36559138-36559160 TCCTGCCGTGCTGGCTTCCAGGG + Intergenic
1183271695 22:36866290-36866312 CCCATCAATTCTGGCTTCCATGG + Intronic
1183335535 22:37243987-37244009 CCCCTCCAAGCTGCCTTCCAGGG + Intronic
1184227156 22:43135630-43135652 CACTTCTGGGCTTCCTTCCAAGG + Intronic
1184376496 22:44117046-44117068 CCCTTCCTTCCTGCCTTCCCTGG + Intronic
1184632067 22:45789558-45789580 CCCTTCACTGGCGCCTTCCCAGG - Intronic
1185088315 22:48752573-48752595 GCCGTCTGTGCTTCCTTCCAAGG + Intronic
1203215831 22_KI270731v1_random:5335-5357 GCCTTCTGAGCTGCCTTCCAAGG - Intergenic
1203274794 22_KI270734v1_random:80056-80078 GCCTTCTGAGCTGCCTTCCAAGG + Intergenic
949683356 3:6541036-6541058 CTCTTCAGAGCTGCCAGCCAGGG + Intergenic
949969704 3:9394785-9394807 CCCTTTGGTCATGCCTTCCATGG - Intergenic
950961322 3:17111099-17111121 CCCATCAGTGATGTCTGCCATGG + Intergenic
951159226 3:19396356-19396378 TCCTCCAGTGCTGCCTTTGAAGG - Intronic
951436343 3:22669685-22669707 CCCTTCATTGCTGCCTGCACAGG - Intergenic
952129194 3:30339619-30339641 CATTTCTTTGCTGCCTTCCATGG + Intergenic
952164137 3:30727981-30728003 CTCTTCAGAGCTGTGTTCCAGGG + Exonic
952344264 3:32469286-32469308 CCTTTCACTGCTGTCTTTCAAGG - Intronic
952402582 3:32976585-32976607 CCCGGCACTGCTGCCTCCCATGG - Intergenic
952818453 3:37465784-37465806 CACTTCAGAGCTGCCCTCAAAGG + Intronic
954324835 3:49857918-49857940 CCCTTCCCCACTGCCTTCCAGGG + Intergenic
954511424 3:51129230-51129252 CCCTTCACTGCTGTCCTACAGGG + Intronic
955223881 3:57045320-57045342 CTCTTCAGTAATGCCTTTCATGG + Intronic
956360509 3:68441872-68441894 CCCTTCACTGCTGTCCTTCAGGG - Intronic
958600864 3:96295006-96295028 CTCTTCAGTGCTGCCTACGCTGG + Intergenic
959083737 3:101829479-101829501 CCCCTCAGTAATGCTTTCCATGG - Intronic
959997922 3:112698754-112698776 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
960814369 3:121658007-121658029 ACCTTCAGTGTAGCCTGCCATGG + Intronic
961224715 3:125232510-125232532 CCCTTCCGTGCTCCCTATCATGG - Exonic
961372409 3:126439727-126439749 CCTTTCTGTGTTGCCTTCCCAGG - Exonic
961619545 3:128212904-128212926 CCTTCCAGGGCTGCCTTCCTGGG + Intronic
964679177 3:159318480-159318502 CCCTTCACTGCTGTCCTTCAGGG + Intronic
965893101 3:173539097-173539119 TCCTTCACTGCTGTCTTTCAAGG + Intronic
966942898 3:184758145-184758167 CCCTTCAGTGCCACCATCCTAGG - Intergenic
967779110 3:193417040-193417062 CCCTTGACTTCTGGCTTCCATGG - Intronic
968604137 4:1523627-1523649 CCCTTCACTTCTGCCTTGCCAGG + Intergenic
968722405 4:2217271-2217293 CCCTTGAGCACTGTCTTCCAGGG + Intronic
968877976 4:3284149-3284171 CCCTTCAGCCCTCCCCTCCAGGG - Intergenic
968970862 4:3792985-3793007 CCCTTCAGGCTTGCCTTCCCAGG - Intergenic
970044756 4:11839269-11839291 TCCTACAGTTCTGCTTTCCAGGG + Intergenic
970075635 4:12216410-12216432 CCCTTCTCTTCTGCATTCCATGG - Intergenic
971755634 4:30704470-30704492 CCTTTCAGTCATTCCTTCCAAGG - Intergenic
972201248 4:36716751-36716773 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
972884722 4:43471542-43471564 CCCTTCAGTCTCGCATTCCATGG - Intergenic
973959153 4:56092183-56092205 CTCCTCAGTGATGCCTTCCCTGG - Intergenic
974925777 4:68296086-68296108 CTCTTCATCTCTGCCTTCCAGGG - Intergenic
975293610 4:72706593-72706615 CCCTTCCTTTCTTCCTTCCAGGG - Intergenic
976031326 4:80758057-80758079 CCCTTTAGTGTTGCCGTCTATGG + Intronic
976896437 4:90117614-90117636 CACTTCATTGATGCCTTCCCTGG - Intergenic
977440358 4:97058658-97058680 CCCTTCAATGCTGCCTTAGAGGG - Intergenic
977490020 4:97699638-97699660 CCCTTCACTGCTGTCCTTCAAGG + Intronic
977701680 4:100029446-100029468 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
978341525 4:107725115-107725137 CCCTTCATTGCTGTCCTTCAGGG + Intergenic
978653740 4:111041113-111041135 TCCTTCAGTCATTCCTTCCATGG - Intergenic
978772098 4:112467354-112467376 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
979531561 4:121774036-121774058 TCCTTCAGTGGTGCCTCCCTTGG - Intergenic
980096858 4:128500782-128500804 CACCTCTTTGCTGCCTTCCAAGG - Intergenic
980629579 4:135414725-135414747 CCCTTCACTGCTGTCCTTCAAGG - Intergenic
980996184 4:139782000-139782022 TCCCTCAATGCTGCATTCCATGG - Intronic
981151496 4:141384255-141384277 CCTTTCTGTGTTGCCTCCCAAGG + Intergenic
981873599 4:149515633-149515655 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
983027456 4:162755724-162755746 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
985832394 5:2243753-2243775 CCCTTCATGGCTGTCCTCCAGGG - Intergenic
986035454 5:3932825-3932847 CCTTTCATTTCTGCCTTTCAGGG - Intergenic
987468134 5:18296554-18296576 CCCTTCAATGCTGTCCTTCAGGG + Intergenic
988169144 5:27632403-27632425 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
988562189 5:32291271-32291293 CCCTTCACTGCTGTCCTTCAGGG - Intronic
989645899 5:43632329-43632351 GCCTTCAGTCCAGCCTTCCAGGG - Intronic
989998358 5:50862631-50862653 CCTTTCAGAGCTCCCTGCCATGG + Intergenic
990328180 5:54698733-54698755 ACCTTCAGTGGTGCCCCCCATGG + Intergenic
990479682 5:56198085-56198107 CTCTTAAATGCTGCCTTCAAAGG + Intronic
992895274 5:81240052-81240074 CCCTCCAATGCTGCCCACCATGG + Intronic
993367412 5:87050529-87050551 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
993791843 5:92219343-92219365 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
996825623 5:127678274-127678296 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
999267663 5:150277390-150277412 CCCATCAGTGCTGATTTCCAAGG - Intronic
999422168 5:151454367-151454389 CCCATGAGTGCTGGCATCCATGG - Intronic
1000417028 5:160994334-160994356 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1000993438 5:167934776-167934798 CCATTCAGGGCAGCCTTCCAGGG + Intronic
1003758670 6:9150516-9150538 CCCTTCACTGCTGTCTGTCAGGG - Intergenic
1004465737 6:15883141-15883163 CCTCTCTGGGCTGCCTTCCAAGG + Intergenic
1004636695 6:17475515-17475537 CCATTCCGTGGTCCCTTCCAAGG - Intronic
1005185232 6:23157498-23157520 CCCTTCACTGCTGTCTTTCAGGG - Intergenic
1006062409 6:31433658-31433680 CCTTTCACTGCTGCCCTTCAGGG - Intergenic
1006389487 6:33750067-33750089 CACTTCACTGCTGCCTTCCCTGG + Intergenic
1006408579 6:33859007-33859029 CACTTTAGTGGTGCCTTCCGGGG - Intergenic
1006505597 6:34486682-34486704 CCCTGCAGGGCTGCCTTCCGGGG + Intronic
1008820461 6:55625585-55625607 CCCTTCATTGCTGTCCTTCAGGG - Intergenic
1009727817 6:67557902-67557924 CCCTTCAGAGCTGCCAGGCAGGG + Intergenic
1010107890 6:72190135-72190157 CCCTTCACTGCTGTCCTTCAGGG + Intronic
1011039285 6:83012839-83012861 CCCTTCATTGCTGTCATTCAAGG + Intronic
1011069164 6:83362096-83362118 CCCTTCACTGCTGTCCTTCAGGG - Intronic
1011264692 6:85503099-85503121 CCCTGCAGTTTTGCTTTCCAAGG - Intergenic
1014363344 6:120507919-120507941 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
1014631699 6:123797234-123797256 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1014704002 6:124724415-124724437 CCATTCAGTGCTTCCACCCAAGG + Intronic
1015430527 6:133125682-133125704 ACCTTTAGTGCTGGCTTGCAGGG - Intergenic
1015466786 6:133557280-133557302 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
1016144353 6:140649840-140649862 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1016147266 6:140692280-140692302 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
1016194507 6:141317442-141317464 CTCTTCAGTGCTTCTTTCCTTGG - Intergenic
1016833612 6:148455916-148455938 GCCTTCAGTGCTGCTTCCCCTGG + Intronic
1017227745 6:152040658-152040680 CCCTTCACTGCTGCCCTTCAGGG + Intronic
1018435007 6:163751609-163751631 CCTTTCTCTCCTGCCTTCCAGGG - Intergenic
1018768541 6:166952834-166952856 CCCTTCAGTGAGGCCCTCCCTGG - Intronic
1020022794 7:4879060-4879082 CCACTCAGTGCTGCCATCCCAGG - Intronic
1020149523 7:5670888-5670910 ACCTTGAGTCCTGCCTTCCCAGG - Intronic
1020377214 7:7501739-7501761 CCCAACGCTGCTGCCTTCCATGG - Intronic
1021534963 7:21693292-21693314 TCCTTCGGTGTTGCATTCCAGGG + Intronic
1022078948 7:27000764-27000786 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1022443518 7:30452188-30452210 CACTTCCGTGCTGCCTTTGAAGG - Exonic
1024241014 7:47435843-47435865 TCCTTAAGTGCTGCCTTTCCAGG - Intronic
1024978203 7:55133244-55133266 CAGCTCAGTGCTGCCTGCCAGGG - Intronic
1026900048 7:74031966-74031988 CTCTTCAGTTCTGCCTGCCAGGG - Intronic
1027050301 7:75017590-75017612 CCCTCCAGAGCTGCCCTCCTCGG + Exonic
1027685861 7:81278390-81278412 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1028192686 7:87870961-87870983 CCTTTCAGTTTTGCCATCCACGG - Intronic
1028237885 7:88383256-88383278 CCCTTCATTGCTGTCCTTCAGGG - Intergenic
1028986517 7:97013322-97013344 CCCTTCAAGGCTGCTTTTCAGGG - Intergenic
1029382735 7:100224061-100224083 CCCTCCAGAGCTGCCCTCCTCGG - Exonic
1030063155 7:105639119-105639141 CCCTCCAGGGCTGCCTTTCAGGG + Intronic
1030368813 7:108674462-108674484 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1030931226 7:115525249-115525271 CCCTTCACTGCTATCTTTCAGGG + Intergenic
1031833062 7:126650447-126650469 CCCTTCACTGCTGTCCTTCAGGG - Intronic
1032153041 7:129446526-129446548 CCCTTCACTGCTGTCCTTCAGGG + Intronic
1032582037 7:133112439-133112461 CCCTGCAGTTCTGTCTTCCCTGG - Intergenic
1033868160 7:145717894-145717916 CCCTTGAGTGCTGTATTCCTAGG + Intergenic
1035165663 7:156988230-156988252 TCCTTCAGCCCTGACTTCCACGG - Intergenic
1035571197 8:673755-673777 CCCTTCATTGCTGCTGTCCTCGG + Exonic
1037364526 8:18107827-18107849 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
1037740805 8:21607856-21607878 CCCTTCACTGCTGAATTTCAGGG - Intergenic
1037934841 8:22908675-22908697 CCTCTCAGAGCTGCCTTCCTTGG - Intronic
1039972068 8:42328491-42328513 CCCTTCAGTGATGTCCTCAAAGG + Intronic
1041149299 8:54914567-54914589 CCTTTTAGTGCTGCCTACCGTGG + Intergenic
1041934610 8:63321764-63321786 CCCTTCACTGCTGTCCTTCAAGG - Intergenic
1044552715 8:93529934-93529956 CCATTCACTGCTGCCTGGCAAGG - Intergenic
1045221901 8:100207499-100207521 CCCTTCACTGCTGTCCTTCAGGG - Intronic
1046328322 8:112679353-112679375 CACTCCAGTTCTGCCTTCCTTGG + Intronic
1046958223 8:120083355-120083377 CTCCACACTGCTGCCTTCCAAGG + Intronic
1052229515 9:26132023-26132045 CTCTTAAGTGTTGCCTTCAATGG - Intergenic
1052368712 9:27641270-27641292 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1052737286 9:32355144-32355166 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
1052895431 9:33743204-33743226 CCCTTCACAGCTGTCTTTCAGGG + Intergenic
1056587430 9:87937885-87937907 CCCGCCAGGGCTGCCTTCCTCGG + Intergenic
1056609446 9:88115057-88115079 CCCACCAGGGCTGCCTTCCTCGG - Intergenic
1058259201 9:102809250-102809272 CCCTTCCGTGCTGTCCTTCAGGG + Intergenic
1058458689 9:105162567-105162589 CTCTTCAGTGCTGGATTCCCTGG - Intergenic
1059446453 9:114341290-114341312 CCCTTCACTGCTGGGTCCCAGGG + Intronic
1059801058 9:117749993-117750015 CTCCCCAGTGCAGCCTTCCAGGG + Intergenic
1062133067 9:134910538-134910560 CCCTGCCCTGCTGCCTTCCTTGG + Intronic
1062209519 9:135356147-135356169 CCCGTCAGTGCTGCCTTGCAAGG - Intergenic
1062214280 9:135380699-135380721 GCCCTCTGTGCTGTCTTCCAAGG + Intergenic
1062590754 9:137273453-137273475 CCCAGCAGTGCTGCCTTCAGCGG + Exonic
1062662266 9:137643872-137643894 GACTTGACTGCTGCCTTCCAGGG + Intronic
1186128888 X:6445150-6445172 CCCATCATTGCTGGCTTCAAAGG - Intergenic
1186173844 X:6904678-6904700 CCCTTGGCTGCTCCCTTCCAGGG - Intergenic
1186776359 X:12868575-12868597 CCCTCCCCTGTTGCCTTCCAGGG + Intronic
1188514247 X:30968321-30968343 CCTATCATTGCTGCCTCCCAAGG + Intronic
1189328899 X:40130793-40130815 CTCTTGTGTCCTGCCTTCCAAGG + Intronic
1190080728 X:47354909-47354931 CCTATCGGGGCTGCCTTCCATGG + Intergenic
1191932977 X:66394596-66394618 CCCTTCACTGCTGTCCTTCAGGG - Intergenic
1193053548 X:77126199-77126221 CCCTTCACTGCTGCCCTTCAGGG - Intergenic
1193904538 X:87226261-87226283 CTCTTCACTGCTGTCTTTCAGGG - Intergenic
1197182149 X:123548205-123548227 CCCTTCATTGCTGTCCTTCAGGG - Intergenic
1199144395 X:144348542-144348564 CCCTTCACTGCTGTCCTTCAGGG + Intergenic
1199852170 X:151732525-151732547 CCCTCAACTGCTGGCTTCCAGGG - Intergenic
1201933837 Y:19384939-19384961 ACCTTCAGGACTGCCTTGCAGGG - Intergenic