ID: 1148214831

View in Genome Browser
Species Human (GRCh38)
Location 17:45828843-45828865
Sequence GGTCCACCTGGTGTTCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148214828_1148214831 6 Left 1148214828 17:45828814-45828836 CCGGGAGTTTGGTGTCTCTGCAG 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1148214831 17:45828843-45828865 GGTCCACCTGGTGTTCTGACTGG 0: 1
1: 0
2: 1
3: 10
4: 99
1148214827_1148214831 7 Left 1148214827 17:45828813-45828835 CCCGGGAGTTTGGTGTCTCTGCA 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1148214831 17:45828843-45828865 GGTCCACCTGGTGTTCTGACTGG 0: 1
1: 0
2: 1
3: 10
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148214831 Original CRISPR GGTCCACCTGGTGTTCTGAC TGG Intronic
900190922 1:1351888-1351910 GGTCCAGCTGGGGCCCTGACAGG + Intergenic
904140389 1:28348450-28348472 TGTCCACCTGGAGTGCTGGCTGG - Intergenic
916793619 1:168146010-168146032 GGTCCACCTGGTCTTGGGACTGG - Intergenic
919157619 1:193787153-193787175 AGGCCTCCTGGTGGTCTGACTGG + Intergenic
922175389 1:223193375-223193397 AGTCCTCCTGGTTGTCTGACTGG + Intergenic
923341566 1:233011946-233011968 GGGCCACCTGAACTTCTGACTGG - Intronic
924550819 1:245075233-245075255 GGTCCGGCAGGTGTTTTGACGGG - Intronic
924796156 1:247293788-247293810 GGTCCACCTGGAGTGCAGGCTGG - Intergenic
1068765248 10:60756204-60756226 GCTCCACCTGGAGTTCCCACTGG - Intergenic
1071134862 10:82441820-82441842 GAGCCTCCTGGTGATCTGACTGG - Intronic
1071378923 10:85038217-85038239 GGACCATCTGGTGGTCTAACTGG - Intergenic
1072982594 10:100111912-100111934 GGGCCACCTGGTGGTCTGGTCGG - Intergenic
1073692116 10:105820565-105820587 GTTCCACTTTGTGTACTGACTGG - Intergenic
1073748254 10:106494526-106494548 GGGCAACCTGGTGGTCTGGCTGG - Intergenic
1075655578 10:124158894-124158916 GCCCCACCTGGCTTTCTGACAGG + Intergenic
1076024640 10:127101314-127101336 GGTCCACCTGTTCTCCTGAAGGG - Intronic
1077014932 11:395318-395340 GGTCCACTTGGTGTTTAGAGGGG + Intronic
1077590855 11:3489908-3489930 GGTCCACATAGTATTCTTACGGG + Intergenic
1083995844 11:66271892-66271914 CATCCACCTGGGGTCCTGACTGG + Intronic
1085028257 11:73252906-73252928 GGTCCACCTGGAGCTGTCACAGG - Intergenic
1086914672 11:92515778-92515800 TGTGCACCTGGTATTTTGACAGG - Intronic
1087688156 11:101288576-101288598 GGGCCATCTGGTGGTCTGGCTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1092612556 12:10187762-10187784 TTGCCAGCTGGTGTTCTGACTGG - Intronic
1095593982 12:43938195-43938217 GGGCCACCTAGTGGTCTGGCTGG + Intronic
1098714736 12:73815540-73815562 GGGCCGTCTGGTGGTCTGACGGG + Intergenic
1106416381 13:29549382-29549404 GGACCACGTGGTGTGCTGAAAGG - Intronic
1106581616 13:31023674-31023696 CATCCACCTGGGGTTCTGGCTGG - Intergenic
1106941998 13:34790031-34790053 GGGCTACCTGGTGGTCTGGCTGG + Intergenic
1112400469 13:99073113-99073135 GGGCCACATGGTGGTCTGGCCGG - Intronic
1117333576 14:54737421-54737443 GGTCAACCTGGAGTTCTGGAAGG - Intronic
1123769377 15:23513131-23513153 GGTCCACTTGGTGGTCTGGATGG + Intergenic
1123974534 15:25540693-25540715 GGGCCACCTGATGGTCTGGCTGG + Intergenic
1128218701 15:65952554-65952576 GTTCACCCTGGTGTTCTGTCTGG + Intronic
1129665905 15:77579230-77579252 GGTCCAGCTGGCGCTCTGTCTGG + Intergenic
1133772801 16:8877356-8877378 GATCCACTTGCTGTTCTGACAGG - Intergenic
1135761349 16:25140734-25140756 GGGCCACTTGGTGGTCTGGCTGG + Intronic
1136557486 16:31016253-31016275 GGGCCATCTGGTGGTCTGGCTGG + Intergenic
1142225144 16:88873532-88873554 GTTCCACCTGGTTTGCTGTCAGG + Intergenic
1144234429 17:13243772-13243794 TGGCCACCTGGTGTTCTGACTGG + Intergenic
1145121131 17:20260884-20260906 GGGCCACCTAGTGTTCTGGTTGG + Intronic
1146054409 17:29574005-29574027 GGTCCATCTGGAGTTTTGAGGGG - Exonic
1148214831 17:45828843-45828865 GGTCCACCTGGTGTTCTGACTGG + Intronic
1152522148 17:80862798-80862820 GGTGCACATGGTGTACAGACGGG + Intronic
1153763010 18:8349885-8349907 GGTCACCCTGGTGTTCACACTGG + Intronic
1157944269 18:51960929-51960951 GGTCCACCTGGGGTACAGGCAGG - Intergenic
1158901373 18:61965025-61965047 AGTCCATCTGGTGATCTGCCTGG - Intergenic
1159055216 18:63456556-63456578 GGTCTACCTGATGTTCTGTGTGG + Intergenic
1160079710 18:75713953-75713975 GGTCCACCTTGTGCTGTCACTGG - Intergenic
1160174015 18:76578736-76578758 GTTCCACCTGGTGCCCTGGCGGG + Intergenic
1162297589 19:9824042-9824064 GGGCCACCTGCTGGTCTGGCAGG + Intronic
1162320677 19:9969437-9969459 GGTCCACACTGTGTTCTGACAGG - Intronic
1164609179 19:29620809-29620831 GCTCCACCTGGAGATCTAACAGG + Intergenic
1164960513 19:32424687-32424709 AGTCCACCTGGGATTCTGAGAGG - Intronic
1164990316 19:32677776-32677798 GGGCCACCTGGTGTTTAAACAGG + Exonic
1165603429 19:37078302-37078324 GGGCCTCCTGGCGTTCTGGCCGG + Intronic
1165853129 19:38862775-38862797 GGGCCACATGGTGTTCTGGCAGG + Intergenic
1166594701 19:44035113-44035135 GGGCCACCTGGTGGTCTGGGTGG + Intergenic
1167711528 19:51114505-51114527 CATCCTCCTGGTTTTCTGACTGG - Intergenic
934697321 2:96409362-96409384 GGGCCACCTGGTGGTCTGGCTGG - Intergenic
946749795 2:222882598-222882620 GATGCAGCTGCTGTTCTGACAGG + Intronic
947394295 2:229672216-229672238 GGCTCACCTGGTGTCCTGTCTGG + Intronic
948653513 2:239463378-239463400 AGTCCCCCTGGTGTTCTCTCAGG + Intergenic
948779391 2:240308533-240308555 GGTCCTCCTGGGGCTCTGAGGGG + Intergenic
948911760 2:241008463-241008485 GGGTGTCCTGGTGTTCTGACTGG + Intronic
1168800446 20:641204-641226 GGTACTCTTGTTGTTCTGACAGG + Intergenic
1169881587 20:10352500-10352522 GGACCACCTGGTGGTCTGGCTGG + Intergenic
1173490157 20:43473247-43473269 GGGCCACCTGGTGGTCTAGCTGG + Intergenic
1173617335 20:44411584-44411606 CGTCCACATGGTGGTCTGAGAGG + Intronic
1173665578 20:44760659-44760681 GGTACACCAGGTGTTATGGCCGG + Intronic
1175733319 20:61369110-61369132 GGTTCAACTGCTGTTTTGACAGG - Intronic
1184087193 22:42271971-42271993 GGACCACCTGGGGCTCTGCCTGG - Intronic
949783799 3:7718648-7718670 GGTAGGCCTGGTCTTCTGACTGG - Intronic
952352707 3:32555970-32555992 GGTCTTCCTGCTGTTCTTACAGG + Intronic
955691865 3:61598873-61598895 TGTTCACCTGGTGTTCTCCCTGG + Intronic
960862708 3:122168133-122168155 GGTCCAGTAGGAGTTCTGACGGG + Intergenic
962432476 3:135332577-135332599 AGTTCACCTGGTTTTCTGTCTGG - Intergenic
974501278 4:62706558-62706580 GGGCCTCCTGTAGTTCTGACTGG - Intergenic
974653640 4:64788396-64788418 TGTACACCTGCTGTTCTGGCAGG - Intergenic
984472779 4:180197606-180197628 CGTCCACCTGGAGTGCTGGCTGG + Intergenic
985383163 4:189416898-189416920 GGTCTACCTGCTGATCTGAATGG + Intergenic
994274670 5:97821833-97821855 GGTCCATGGGGTGTTCTGCCAGG + Intergenic
1001196515 5:169677962-169677984 GGTCCACCTGGAGCACAGACTGG + Intronic
1003254950 6:4466957-4466979 GGGCCACCTGGTGGTCTGGCTGG - Intergenic
1005157019 6:22819022-22819044 GGTCCATTGGGTGTTCTGCCAGG + Intergenic
1005373024 6:25154684-25154706 GGGCAACCTGGTGATCTGGCTGG - Intergenic
1006519436 6:34562914-34562936 GGTGCACCTGGTGCTCTGTGGGG - Intergenic
1008822499 6:55650827-55650849 TGTCCACAGGGTGTTCTGCCAGG + Intergenic
1010565034 6:77400529-77400551 TGTCCACCTGGAGTGCTGGCTGG - Intergenic
1013080525 6:106808144-106808166 GGGCCACCTGGTGGTTTGGCTGG - Intergenic
1017180348 6:151546222-151546244 GGTCCACCTGATGCTCTCATGGG + Intronic
1017839538 6:158210105-158210127 GGGCCAGCTGGAGTTCTGAGTGG - Intergenic
1020324919 7:6966988-6967010 GGTCCACATAGTATTCTTACGGG + Intergenic
1027239915 7:76320315-76320337 GGACCATCTTGTTTTCTGACTGG - Intergenic
1027254640 7:76423419-76423441 GGGCCACCTGGTAGTCTGGCTGG + Intronic
1030069677 7:105688100-105688122 GGGCCACCTGGTGGTCTAGCCGG - Intronic
1035724885 8:1818128-1818150 GGTGCACCTGGCGCTCTGCCTGG - Intergenic
1037079307 8:14763965-14763987 GGTACACCTGGTGTTCAGATGGG + Intronic
1042413285 8:68489982-68490004 GGTCAACATGGAGTTCTGCCTGG - Intronic
1042626109 8:70758966-70758988 GGTCTACCTATTGTTCTGACGGG + Intronic
1043748931 8:83910940-83910962 GGGCCATCTGGTGGTCTGGCTGG - Intergenic
1048135991 8:131746766-131746788 GGTGCATCTAATGTTCTGACTGG - Intergenic
1052979514 9:34437967-34437989 GGGCCACCTGGAGTTCCGAGTGG + Intronic
1056063187 9:82906326-82906348 GGTCCACCTGTGCTGCTGACTGG + Intergenic
1061555650 9:131366977-131366999 GGGCCACCTGGTGGTCTGGCTGG - Intergenic
1185925631 X:4142677-4142699 GGTCCACCTGGAGCTCAGGCTGG - Intergenic
1186194796 X:7099659-7099681 GGTCCACCTTGTCTTCTTAGTGG + Intronic
1187123702 X:16433775-16433797 GGTCCAACTGCTCTTCTCACTGG - Intergenic
1195656220 X:107333887-107333909 AATGCACCTGGTGATCTGACAGG + Intergenic
1201729739 Y:17191068-17191090 GGTCCTCCTTGTGTTCTGGGAGG - Intergenic