ID: 1148215034

View in Genome Browser
Species Human (GRCh38)
Location 17:45829758-45829780
Sequence TTCCAGGATGGACAGTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 173}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148215034_1148215044 6 Left 1148215034 17:45829758-45829780 CCCTGTGACTGTCCATCCTGGAA 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1148215044 17:45829787-45829809 GGAGTAGAAGGCACCCCCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1148215034_1148215041 -6 Left 1148215034 17:45829758-45829780 CCCTGTGACTGTCCATCCTGGAA 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1148215041 17:45829775-45829797 CTGGAATGGCAGGGAGTAGAAGG 0: 1
1: 0
2: 1
3: 41
4: 500
1148215034_1148215046 13 Left 1148215034 17:45829758-45829780 CCCTGTGACTGTCCATCCTGGAA 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1148215046 17:45829794-45829816 AAGGCACCCCCAGGGGAAGCGGG 0: 1
1: 0
2: 2
3: 25
4: 265
1148215034_1148215045 12 Left 1148215034 17:45829758-45829780 CCCTGTGACTGTCCATCCTGGAA 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1148215045 17:45829793-45829815 GAAGGCACCCCCAGGGGAAGCGG 0: 1
1: 0
2: 1
3: 34
4: 336
1148215034_1148215043 5 Left 1148215034 17:45829758-45829780 CCCTGTGACTGTCCATCCTGGAA 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1148215043 17:45829786-45829808 GGGAGTAGAAGGCACCCCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 167
1148215034_1148215051 23 Left 1148215034 17:45829758-45829780 CCCTGTGACTGTCCATCCTGGAA 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1148215051 17:45829804-45829826 CAGGGGAAGCGGGCATCGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 149
1148215034_1148215042 4 Left 1148215034 17:45829758-45829780 CCCTGTGACTGTCCATCCTGGAA 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1148215042 17:45829785-45829807 AGGGAGTAGAAGGCACCCCCAGG 0: 1
1: 0
2: 1
3: 21
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148215034 Original CRISPR TTCCAGGATGGACAGTCACA GGG (reversed) Intronic