ID: 1148216621

View in Genome Browser
Species Human (GRCh38)
Location 17:45836992-45837014
Sequence AAGCCCCGCAGCTCCTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148216619_1148216621 8 Left 1148216619 17:45836961-45836983 CCAGGAACAGACAAAGGTGACAC No data
Right 1148216621 17:45836992-45837014 AAGCCCCGCAGCTCCTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148216621 Original CRISPR AAGCCCCGCAGCTCCTGCTG AGG Intergenic
No off target data available for this crispr