ID: 1148217378

View in Genome Browser
Species Human (GRCh38)
Location 17:45840426-45840448
Sequence GGGTGGCGGGACTGAAGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148217363_1148217378 16 Left 1148217363 17:45840387-45840409 CCTCCAGGAAAGGAGTTGAATCT No data
Right 1148217378 17:45840426-45840448 GGGTGGCGGGACTGAAGTCTTGG No data
1148217365_1148217378 13 Left 1148217365 17:45840390-45840412 CCAGGAAAGGAGTTGAATCTGGA No data
Right 1148217378 17:45840426-45840448 GGGTGGCGGGACTGAAGTCTTGG No data
1148217362_1148217378 17 Left 1148217362 17:45840386-45840408 CCCTCCAGGAAAGGAGTTGAATC No data
Right 1148217378 17:45840426-45840448 GGGTGGCGGGACTGAAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148217378 Original CRISPR GGGTGGCGGGACTGAAGTCT TGG Intergenic
No off target data available for this crispr