ID: 1148219176

View in Genome Browser
Species Human (GRCh38)
Location 17:45850080-45850102
Sequence CCCATTTCACAGATGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148219170_1148219176 2 Left 1148219170 17:45850055-45850077 CCAAGAATACTCTGCAGCAACTC No data
Right 1148219176 17:45850080-45850102 CCCATTTCACAGATGGGGCTGGG No data
1148219168_1148219176 6 Left 1148219168 17:45850051-45850073 CCTCCCAAGAATACTCTGCAGCA No data
Right 1148219176 17:45850080-45850102 CCCATTTCACAGATGGGGCTGGG No data
1148219167_1148219176 17 Left 1148219167 17:45850040-45850062 CCTTTCTTCTTCCTCCCAAGAAT No data
Right 1148219176 17:45850080-45850102 CCCATTTCACAGATGGGGCTGGG No data
1148219169_1148219176 3 Left 1148219169 17:45850054-45850076 CCCAAGAATACTCTGCAGCAACT No data
Right 1148219176 17:45850080-45850102 CCCATTTCACAGATGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148219176 Original CRISPR CCCATTTCACAGATGGGGCT GGG Intergenic
No off target data available for this crispr