ID: 1148220774

View in Genome Browser
Species Human (GRCh38)
Location 17:45860261-45860283
Sequence GTCTCTAAGGGGATTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148220762_1148220774 12 Left 1148220762 17:45860226-45860248 CCTCAAATCCATCTCCCACAGTA No data
Right 1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG No data
1148220761_1148220774 13 Left 1148220761 17:45860225-45860247 CCCTCAAATCCATCTCCCACAGT No data
Right 1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG No data
1148220767_1148220774 -2 Left 1148220767 17:45860240-45860262 CCCACAGTAGTTTTGGGTGAGGT No data
Right 1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG No data
1148220764_1148220774 4 Left 1148220764 17:45860234-45860256 CCATCTCCCACAGTAGTTTTGGG No data
Right 1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG No data
1148220768_1148220774 -3 Left 1148220768 17:45860241-45860263 CCACAGTAGTTTTGGGTGAGGTC No data
Right 1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148220774 Original CRISPR GTCTCTAAGGGGATTGTGGA GGG Intergenic
No off target data available for this crispr