ID: 1148221884

View in Genome Browser
Species Human (GRCh38)
Location 17:45868790-45868812
Sequence CTTACTCCTCAGTCCTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148221884_1148221889 25 Left 1148221884 17:45868790-45868812 CCTGGACAGGACTGAGGAGTAAG No data
Right 1148221889 17:45868838-45868860 AGAGGTGCTATAGCATCTAGTGG No data
1148221884_1148221887 7 Left 1148221884 17:45868790-45868812 CCTGGACAGGACTGAGGAGTAAG No data
Right 1148221887 17:45868820-45868842 TATTTAGACCAAAGTGATAGAGG No data
1148221884_1148221890 26 Left 1148221884 17:45868790-45868812 CCTGGACAGGACTGAGGAGTAAG No data
Right 1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148221884 Original CRISPR CTTACTCCTCAGTCCTGTCC AGG (reversed) Intergenic
No off target data available for this crispr