ID: 1148221890

View in Genome Browser
Species Human (GRCh38)
Location 17:45868839-45868861
Sequence GAGGTGCTATAGCATCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148221884_1148221890 26 Left 1148221884 17:45868790-45868812 CCTGGACAGGACTGAGGAGTAAG No data
Right 1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG No data
1148221883_1148221890 27 Left 1148221883 17:45868789-45868811 CCCTGGACAGGACTGAGGAGTAA No data
Right 1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148221890 Original CRISPR GAGGTGCTATAGCATCTAGT GGG Intergenic
No off target data available for this crispr