ID: 1148224948

View in Genome Browser
Species Human (GRCh38)
Location 17:45892864-45892886
Sequence CTAGTTCAAGACCTCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148224948_1148224952 21 Left 1148224948 17:45892864-45892886 CCAAGATAGAGGTCTTGAACTAG No data
Right 1148224952 17:45892908-45892930 AACAACAAAAAGTCAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148224948 Original CRISPR CTAGTTCAAGACCTCTATCT TGG (reversed) Intergenic
No off target data available for this crispr