ID: 1148225644

View in Genome Browser
Species Human (GRCh38)
Location 17:45896366-45896388
Sequence GGATGGGTGGGGAGCCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 642
Summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 586}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148225624_1148225644 25 Left 1148225624 17:45896318-45896340 CCACGCCACACCAGGTTGCCCAG 0: 1
1: 0
2: 1
3: 25
4: 229
Right 1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG 0: 1
1: 0
2: 6
3: 49
4: 586
1148225630_1148225644 7 Left 1148225630 17:45896336-45896358 CCCAGCGAGGGACGCTGGCTACC 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG 0: 1
1: 0
2: 6
3: 49
4: 586
1148225628_1148225644 15 Left 1148225628 17:45896328-45896350 CCAGGTTGCCCAGCGAGGGACGC 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG 0: 1
1: 0
2: 6
3: 49
4: 586
1148225625_1148225644 20 Left 1148225625 17:45896323-45896345 CCACACCAGGTTGCCCAGCGAGG 0: 1
1: 0
2: 2
3: 19
4: 228
Right 1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG 0: 1
1: 0
2: 6
3: 49
4: 586
1148225631_1148225644 6 Left 1148225631 17:45896337-45896359 CCAGCGAGGGACGCTGGCTACCC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG 0: 1
1: 0
2: 6
3: 49
4: 586

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148225644 Original CRISPR GGATGGGTGGGGAGCCCTGG CGG Intronic
900131249 1:1088240-1088262 GGAGGCGTGGGGGACCCTGGGGG - Intronic
900131290 1:1088325-1088347 GGAGGCGTGGGGGGTCCTGGGGG - Intronic
900141811 1:1141838-1141860 GCATGGTTGTGGATCCCTGGGGG + Intergenic
900143950 1:1150065-1150087 GCCTGGCTGGGGAGCCTTGGAGG - Intergenic
900163969 1:1237372-1237394 GGATGGGTGGGGAGCGCCTGGGG - Intergenic
900423633 1:2566516-2566538 GGGTCGGTGGGGACCGCTGGGGG - Intergenic
900467477 1:2832896-2832918 GGGCGGGTGAGGAGCCATGGTGG - Intergenic
900495934 1:2976256-2976278 AGCTGGGTGGGCAGCCCTGCTGG - Intergenic
900547626 1:3237348-3237370 GTGGGGGTGGGGAGCCCAGGAGG - Intronic
900727199 1:4224496-4224518 GGGTGGGCAGGGAGTCCTGGAGG + Intergenic
900940665 1:5796583-5796605 GTGTGGATTGGGAGCCCTGGTGG - Intergenic
900951494 1:5860477-5860499 GGATGGGTGGGCTGCCCAGGTGG + Intergenic
901055925 1:6448568-6448590 AGCTGGGTGGGGAGGCGTGGGGG + Intronic
901455810 1:9362164-9362186 GGGAGGGTGGGTGGCCCTGGTGG - Intronic
901635321 1:10667797-10667819 GGATGGGTGGGGGCCCGGGGAGG - Intronic
901705771 1:11071886-11071908 AGATTGGTGGGGAGTGCTGGAGG - Intronic
902215538 1:14932229-14932251 GGGAGGGTGGGGAGCCATAGTGG - Intronic
902478469 1:16700071-16700093 AGCTGGGTGGGGAGGCGTGGGGG - Intergenic
902930871 1:19730641-19730663 GGAAGGGTGGTGATCCCTAGAGG + Intronic
903814059 1:26051762-26051784 GGAGGGGTCGGGGCCCCTGGAGG - Exonic
903875186 1:26469169-26469191 GAAGGGGAGTGGAGCCCTGGAGG - Exonic
904169198 1:28579682-28579704 GGATGCGTGTGAAGCTCTGGAGG - Intergenic
904319898 1:29689843-29689865 GGATGGATGGGGAGCTCTGAGGG + Intergenic
904384125 1:30130500-30130522 GGAGGGAGGGGGAGGCCTGGTGG - Intergenic
905179563 1:36157403-36157425 GGAGGGGAGGGGAGCTTTGGTGG - Intronic
905894747 1:41538238-41538260 GTGTGGGTGGGGAGGTCTGGAGG + Intronic
905927338 1:41760826-41760848 GGAAGGCTGGGGAGACCAGGTGG - Intronic
906292108 1:44626076-44626098 GGATGGGTAGAGACCCCTTGAGG - Intronic
907560478 1:55382906-55382928 GGCTGGGAGGGGAGGGCTGGGGG + Intergenic
908117588 1:60955029-60955051 GGTTGAGTGGGGAGCACTGTTGG + Intronic
909608446 1:77530167-77530189 AGAATTGTGGGGAGCCCTGGAGG + Intronic
909931462 1:81503736-81503758 AGGTGGCTGGGGAACCCTGGAGG - Intronic
909977705 1:82064696-82064718 GGATGGGTGGGCAGCACTGGGGG - Intergenic
910244078 1:85120292-85120314 GGAAGGGAGTGGAACCCTGGAGG + Intronic
912228995 1:107770272-107770294 TGATGGGGGGGGAGGGCTGGTGG - Intronic
912391565 1:109306807-109306829 GGGAGGGTGGGGAGGCCGGGTGG - Intronic
912431471 1:109630464-109630486 GGTTGGGTGGGGGGCGGTGGGGG + Intronic
912454184 1:109786887-109786909 GGCTGGCCTGGGAGCCCTGGGGG + Intergenic
913211982 1:116589674-116589696 GGAAGGGTATGGAGCCCAGGGGG - Intronic
914336005 1:146715486-146715508 GCAGGGGTGGGCAGCCCTGCAGG - Intergenic
915565710 1:156711485-156711507 GGCAGGCTGGGGGGCCCTGGAGG - Intergenic
915944711 1:160141348-160141370 GGAAAGATGGGGAGCTCTGGAGG + Exonic
916060140 1:161092758-161092780 GGATGGGTGGGGTGGTGTGGGGG + Intergenic
916132650 1:161624755-161624777 GGAATGGTGGGGAGGTCTGGGGG + Intronic
916172208 1:162009799-162009821 GGAGAGGTGGGGAGCTCTTGAGG - Intronic
916706617 1:167357349-167357371 GGGTGGGGGGGGAGGCGTGGGGG - Intronic
916732938 1:167582552-167582574 TGTTTGGTGGGAAGCCCTGGAGG - Intergenic
917452479 1:175158498-175158520 GGATGGCTGGGGAGAGGTGGAGG - Intronic
917981485 1:180272248-180272270 GGAGGGGAGGGGAGACCTTGGGG - Intronic
918318687 1:183344896-183344918 GGATGGGGAGGAAGCCCTGCCGG - Intronic
918446285 1:184620419-184620441 GGAAGGGTAGGGAGCCCTATAGG - Exonic
920248372 1:204605465-204605487 GGATGGGTGGGGACCCAGAGAGG + Intergenic
920674443 1:208029497-208029519 GGCTGGGCGGGGAGCGCAGGTGG - Intronic
921925930 1:220710234-220710256 GGATGGGCAGGGAGGCCTGTGGG + Intergenic
922028261 1:221773691-221773713 GGAAGGGTGGGGAGGCCTGTAGG + Intergenic
922942340 1:229478436-229478458 GGAAGGCTGGGGAGAACTGGGGG + Intronic
1062804317 10:405817-405839 GGCTGTGTGAGGAGCCCTGGAGG - Intronic
1063424794 10:5942538-5942560 GGGTGGGTGGTGCACCCTGGAGG - Intronic
1064352441 10:14588691-14588713 TGATGGGTGGGGAGGAGTGGAGG - Intronic
1065631315 10:27683869-27683891 GGATTGCTTGTGAGCCCTGGGGG - Intronic
1065879841 10:30028916-30028938 GGATGTGCGGGGAGCCCCTGAGG + Exonic
1066055832 10:31679099-31679121 GAAGAGGTGGGGAGCGCTGGGGG + Intergenic
1067110541 10:43396910-43396932 GGAGGGGAGGGGGCCCCTGGCGG + Intronic
1067534671 10:47100132-47100154 GAATGGGTGGGGCACCTTGGAGG - Intergenic
1067821470 10:49534816-49534838 GGATGAGTGGGGCCCACTGGGGG - Intronic
1067848599 10:49741032-49741054 GGCAGGCTGGGGAGGCCTGGTGG - Intronic
1068492649 10:57743300-57743322 GGTTTGGTGGGGAGGGCTGGTGG - Intergenic
1069680016 10:70277694-70277716 GGATGGGTAGGCAGCTGTGGAGG + Intronic
1069891105 10:71652992-71653014 GGGTGGGTGGGGACCCTTGCAGG - Intronic
1069895643 10:71678669-71678691 GGAGTGGTGGGGACCACTGGAGG + Intronic
1070729294 10:78814158-78814180 GGAGAGGTGGTGAGCACTGGAGG + Intergenic
1073326482 10:102646353-102646375 CTCTGGGTGGGGATCCCTGGAGG + Intronic
1073473109 10:103736010-103736032 TGGTGGGTGAGGAGCCCTGGAGG + Intronic
1073952827 10:108830358-108830380 GCATGGCTGGGGAGGCCTCGGGG + Intergenic
1074096517 10:110318164-110318186 AGATGGATGGGGAGGCCAGGAGG - Intergenic
1074160808 10:110835005-110835027 TAGTGGGTGGGGAGCCTTGGAGG - Intronic
1074445377 10:113517336-113517358 CGATGGGTGGGGAACCCAGCTGG - Intergenic
1075633585 10:124015912-124015934 GGAGTGGTGACGAGCCCTGGTGG + Intronic
1075753995 10:124796424-124796446 GGTTTGGTGGGGAGGCATGGTGG - Intergenic
1076427892 10:130380522-130380544 GGATGGATGGGCTGCCCTGGTGG + Intergenic
1076527802 10:131123392-131123414 GAAGAGGTGAGGAGCCCTGGGGG + Intronic
1076631188 10:131853263-131853285 GGGTGGGTGGGGGACCCTGGGGG - Intergenic
1076741432 10:132487717-132487739 GGAAGGATGTGGAACCCTGGAGG - Intergenic
1076798227 10:132809043-132809065 GGGTGGTGGGGGCGCCCTGGAGG - Intronic
1077191161 11:1256453-1256475 GGATGGGTGGGGCTCGGTGGCGG - Intronic
1077231247 11:1459047-1459069 GCATGGGTGGGGAATACTGGGGG - Intronic
1077358812 11:2130770-2130792 GGGTGGGTGGGGGGCAGTGGGGG - Intronic
1078076795 11:8169320-8169342 GGGTGGGTGGGGGGCAGTGGTGG - Intergenic
1078083970 11:8222876-8222898 GGATGGCTGGGCACTCCTGGGGG - Intergenic
1080608486 11:33884409-33884431 TGAGGGGTGGGGTGCCCTGATGG + Intronic
1081366127 11:42237715-42237737 GGGAGGGAGGAGAGCCCTGGAGG - Intergenic
1081629844 11:44681638-44681660 CCATGGGTGGGGTGGCCTGGAGG + Intergenic
1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG + Intronic
1082836875 11:57657540-57657562 GGAGGGGTGAGGAGGCGTGGCGG - Exonic
1082862878 11:57872349-57872371 GGATGCTTGAGGAGACCTGGAGG - Intergenic
1082997128 11:59263357-59263379 GGAAGGGTGGGGACCCCAGTGGG - Intergenic
1083695739 11:64440997-64441019 GGCTGGGGGTGGAGGCCTGGGGG + Intergenic
1083864330 11:65445620-65445642 GGGTGGGAGGAGAGGCCTGGAGG - Intergenic
1084218152 11:67662737-67662759 GGATGTGAGAGGATCCCTGGGGG + Exonic
1084426108 11:69085333-69085355 GGGTGGGCGGGAAGCCTTGGCGG + Intronic
1084889324 11:72228937-72228959 GGTGGGGTGGGGGTCCCTGGTGG - Intronic
1089128165 11:116191880-116191902 GGAGGGGGTGGGAGCCATGGAGG + Intergenic
1089345188 11:117786563-117786585 AGGTGGGGTGGGAGCCCTGGGGG - Intronic
1089395284 11:118132565-118132587 GGCTGCGTGGGGAACCCGGGTGG + Intergenic
1089479453 11:118792320-118792342 GGTGGAGTGGGGAGGCCTGGTGG + Intergenic
1089777431 11:120848150-120848172 GGATGGCTGGGCAGCCGTTGAGG + Intronic
1090260264 11:125314355-125314377 AGATGGGTTGGGAGCCAGGGTGG + Intronic
1090423682 11:126592689-126592711 GCCAGGGTGGGGAGCCCAGGAGG + Intronic
1090888149 11:130897620-130897642 GGATTGGTGTGGAGTCCTGATGG - Intronic
1090939008 11:131371592-131371614 GGCTGAGCCGGGAGCCCTGGGGG + Intronic
1091000355 11:131905823-131905845 GGAGGGGTGGGGTGCTCTGAAGG - Intronic
1091787361 12:3251181-3251203 AGATGGCTGGGGAGACTTGGTGG + Intronic
1092194787 12:6542655-6542677 GGCTGGGTGAGAAGCCCTAGTGG + Intronic
1093682009 12:22013471-22013493 CGATGGCTGGGGAGCCCTACTGG + Intergenic
1096077025 12:48812398-48812420 GGCTGCCTGGGAAGCCCTGGGGG + Intergenic
1096714878 12:53485268-53485290 GAGTGGGTGGCCAGCCCTGGGGG - Intronic
1096780717 12:53990680-53990702 GGATGGGTGGGGGGCTCTTGGGG - Intronic
1096995805 12:55837427-55837449 GGCTGGGGGTGGACCCCTGGGGG - Intronic
1097043694 12:56171778-56171800 GGATGGGTTGGTAGGCCAGGGGG + Exonic
1097046069 12:56188953-56188975 GGCTCCGTGGGGAGCTCTGGCGG + Intronic
1097157836 12:57025767-57025789 GGATGGTGGGGGAGCCGGGGCGG + Intronic
1100444850 12:94650675-94650697 GGGTGGGTGGGGGGTCCAGGCGG - Intergenic
1101065797 12:101019064-101019086 GGAGGGGTGGGGAGACTTGCTGG + Intronic
1101824619 12:108210394-108210416 GGAGTGATGGGGAGCCATGGAGG - Intronic
1103368123 12:120398094-120398116 GGAACGGTGGGGAGGGCTGGCGG - Intergenic
1103377640 12:120469331-120469353 CGGGGGGAGGGGAGCCCTGGGGG + Intronic
1103730297 12:123022901-123022923 GTTTGGGTGGAGGGCCCTGGGGG - Intronic
1103738187 12:123073928-123073950 GGTTGGGTGAGGAGAGCTGGGGG - Intronic
1103915212 12:124372472-124372494 GGTGGGGTGGGTGGCCCTGGGGG + Exonic
1103948755 12:124540756-124540778 GGATGGGGGTGGAGAGCTGGAGG + Intronic
1104132282 12:125905897-125905919 TGAGGGGTGGGGAGCCTTGTAGG - Intergenic
1104626608 12:130361346-130361368 AGATGGGAGGAGAGCTCTGGAGG + Exonic
1105215228 13:18280300-18280322 GGAAGGGTATGGAGCCCAGGGGG - Intergenic
1105811730 13:24001623-24001645 GGATGAGTGTGGTGCCCTGGTGG - Intronic
1105932765 13:25068080-25068102 GGATGGGTAGGCAGCGCTGGTGG + Intergenic
1106800872 13:33254823-33254845 GGATGGATGGGGAGCCAAAGAGG - Intronic
1113075999 13:106468556-106468578 GGTGGTGTGGGGGGCCCTGGTGG + Intergenic
1113404615 13:110026724-110026746 GGCTGGGGGTGCAGCCCTGGAGG - Intergenic
1113421165 13:110172576-110172598 GGATGGGTGCTGAGCCCAGAGGG - Intronic
1113611166 13:111645874-111645896 GGCTGGGTGGGGATCCCACGGGG - Intronic
1113713709 13:112488730-112488752 TGGTGGGTGTGGAGACCTGGGGG - Intronic
1113973754 13:114211210-114211232 GGATGGAGAGGGAGCCATGGGGG - Intergenic
1114193475 14:20458195-20458217 GTGGGGGTGGGTAGCCCTGGGGG - Exonic
1114266249 14:21074355-21074377 GGAGGGCTGGGAAGCCCTGGAGG - Exonic
1114459418 14:22877235-22877257 AGATGGGAGGGGAGCCTTGATGG - Exonic
1115739427 14:36372588-36372610 GGAGGGGTGGGGAGACCAGAAGG - Intergenic
1116734410 14:48671018-48671040 AGGTGGGTGGGAAGCCCTGGAGG - Intergenic
1117553489 14:56859997-56860019 GGATTTGTGGGGAGCACAGGAGG - Intergenic
1118862382 14:69674554-69674576 GGAAGAGTGGGGAGCTCTGGAGG - Intronic
1119182616 14:72614881-72614903 GGAGGGGTGAGGATCTCTGGTGG - Intergenic
1119472515 14:74908816-74908838 GGCTGGGTGTAGTGCCCTGGTGG - Intronic
1119644744 14:76340095-76340117 GGCAGGGTGGGGAGCCCAGGAGG + Intronic
1119756491 14:77123726-77123748 TGGTGGGTGGGGAGCTATGGAGG + Intronic
1120669850 14:87350980-87351002 GGATGGATGGGGATCCCCTGGGG - Intergenic
1122156015 14:99750863-99750885 GGAAGGCTGGGGTGGCCTGGGGG + Intronic
1122292562 14:100687497-100687519 GGGTGGGTGGAGAGGCCAGGAGG + Intergenic
1122302102 14:100737076-100737098 GGAAGGGTGGGGAGAACGGGAGG - Exonic
1122540535 14:102495550-102495572 GGCTGGGTGGGGAGGCCGGGCGG + Intronic
1122843057 14:104476090-104476112 GGAGGGGTTGGGAGTCCAGGGGG - Intronic
1122855238 14:104556882-104556904 GGGTGGGTGAGGGGGCCTGGGGG - Intronic
1123117437 14:105901002-105901024 GACAGGGTGGGGTGCCCTGGAGG + Intergenic
1123403038 15:20004988-20005010 GGAGGGGACAGGAGCCCTGGAGG - Intergenic
1123512378 15:21011642-21011664 GGAGGGGACAGGAGCCCTGGAGG - Intergenic
1123783266 15:23646473-23646495 GGATGGGTGGTGGGCCAGGGCGG + Exonic
1124039289 15:26085023-26085045 GGTGGGGTGGGGAGACATGGGGG + Intergenic
1124438622 15:29671212-29671234 GGAAGGGTCCGGAGCCCAGGAGG - Intergenic
1124706620 15:31972017-31972039 GGGGAGGTGGGGAGCTCTGGAGG - Intergenic
1127119231 15:55757052-55757074 GGAAGGGAGGTGAGACCTGGAGG + Intergenic
1127732352 15:61812517-61812539 GGGAGGGTGGGGAGGACTGGTGG - Intergenic
1128157726 15:65402317-65402339 GGCTGGGTGGGGAAACCTGGGGG - Intronic
1128666951 15:69545309-69545331 GGATGGGTGGAGGGCACAGGAGG - Intergenic
1128678064 15:69626313-69626335 GGTTGGGTGAGGAGCCCTGGAGG - Intergenic
1128874769 15:71193084-71193106 GGATGGGCGGGGATCCTGGGGGG + Intronic
1129002810 15:72348010-72348032 GGGTGGGTGGGGTCCCTTGGGGG - Intronic
1129260580 15:74365138-74365160 GGCTGGGAGGGGAGACCAGGAGG - Intronic
1129295125 15:74596041-74596063 AGGTGGCTGGGGAACCCTGGAGG - Exonic
1129652882 15:77504169-77504191 GCATAAGTGGGGAGCCCTGTGGG + Intergenic
1130984927 15:88838589-88838611 GGATGGATGGGGAGGCGGGGTGG + Intronic
1131119785 15:89814949-89814971 GGACGGGGGAGGAGCCCGGGCGG - Intronic
1132323112 15:100941883-100941905 GGAGGAGTGGGGAGCCATAGTGG - Intronic
1132463448 16:66838-66860 GCATGGGTGAGGGGCCCTGGAGG - Intronic
1132717553 16:1299495-1299517 GGAGGAGGAGGGAGCCCTGGGGG - Intergenic
1132807209 16:1780352-1780374 GGAGGGGTGGGGGTCCCTGTGGG - Intronic
1132858660 16:2058921-2058943 GGATGGGTGGGCAGGCGTGAGGG - Intronic
1132976009 16:2711562-2711584 GGGTGGGTGGGCAGGTCTGGGGG - Intergenic
1133769453 16:8859285-8859307 TGATGGGTGGGGGGCTGTGGTGG + Exonic
1134059802 16:11192316-11192338 AGAAGGATGGGGAGCCCTGGAGG + Intergenic
1134339392 16:13331245-13331267 GGCAGGTGGGGGAGCCCTGGAGG + Intergenic
1136083375 16:27867642-27867664 GGTTGGGTGGGGAACCCAGCAGG - Intronic
1136247129 16:28982476-28982498 GGAAGGGTGCAGAGCCCAGGAGG - Exonic
1136680647 16:31960109-31960131 GGATGCGTGAGGTGACCTGGGGG + Intergenic
1136680681 16:31960278-31960300 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1136680765 16:31960656-31960678 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1136780995 16:32901739-32901761 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1136781046 16:32901989-32902011 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1136781069 16:32902095-32902117 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1136888773 16:33951930-33951952 GGATGTGTGAGGTGACCTGGGGG - Intergenic
1136888826 16:33952180-33952202 GGATGTGTGAGGTGACCTGGGGG - Intergenic
1137673208 16:50291327-50291349 GGATGGTGGGGCAGCTCTGGGGG + Intronic
1138085248 16:54127501-54127523 GGCTGAGCGGGGAGCCCAGGAGG - Intergenic
1138249797 16:55493073-55493095 GGTTGGGTGGGCACCCCTGGGGG + Intronic
1138535450 16:57657545-57657567 AGATGTGTGCGGCGCCCTGGTGG - Intronic
1139472913 16:67187721-67187743 GGATACGTGGGCACCCCTGGGGG - Exonic
1139579158 16:67861945-67861967 GGAAGGGTGGGGATCGCAGGAGG + Intronic
1139721510 16:68859731-68859753 GGCTGGGTTGGTACCCCTGGGGG + Intronic
1139997619 16:70995737-70995759 GGAGGGGTGGGCAGCCCTGCAGG + Intronic
1140406830 16:74716863-74716885 GGATGGGTGGGGTGTGCTGGCGG + Intronic
1140485672 16:75291175-75291197 GGTGGGGAGGTGAGCCCTGGGGG - Intergenic
1141133058 16:81447878-81447900 TGATGGGACGAGAGCCCTGGTGG - Intronic
1141623723 16:85250426-85250448 GGATGGCTGGTGAGCCCAGCTGG + Intergenic
1141807958 16:86354439-86354461 AGTTGGGTGGGGAGTACTGGGGG - Intergenic
1141887323 16:86901492-86901514 GGAGTGCTGGGGAGCCTTGGAGG + Intergenic
1142139694 16:88467392-88467414 GGAGGGGTGGGGAGACCTCAGGG - Intronic
1142195418 16:88737271-88737293 GGAGGGGTTGGGGGACCTGGAGG + Intronic
1142356244 16:89603514-89603536 GGGCTGGAGGGGAGCCCTGGGGG + Intergenic
1142356271 16:89603576-89603598 GGCTGGAGGGGAAGCCCTGGGGG + Intergenic
1142356279 16:89603596-89603618 GGGCTGGAGGGGAGCCCTGGAGG + Intergenic
1142356297 16:89603637-89603659 GGGCTGGAGGGGAGCCCTGGGGG + Intergenic
1142356324 16:89603699-89603721 GGCTGGAGGGGAAGCCCTGGGGG + Intergenic
1142356343 16:89603738-89603760 GGCTGGAGGGGAAGCCCTGGGGG + Intergenic
1142356351 16:89603758-89603780 GGGCTGGAGGGGAGCCCTGGAGG + Intergenic
1142356407 16:89603916-89603938 GGGTTGGAGGGGAGCACTGGGGG + Intergenic
1142356451 16:89604036-89604058 GGGTTGGAGGGGAGCACTGGAGG + Intergenic
1142356474 16:89604099-89604121 GGCTGGAGGGGAAGCCCTGGGGG + Intergenic
1142356484 16:89604119-89604141 GGGCTGGAGGGGAGCCCTGGGGG + Intergenic
1142356517 16:89604202-89604224 GGCTGGAGGGGGAGCCCTGGGGG + Intergenic
1142356627 16:89604506-89604528 GGACTGGAGGGGAGCACTGGGGG + Intergenic
1142396974 16:89837592-89837614 GGCTGGGTCGGGATCCCTGCAGG + Intronic
1203083591 16_KI270728v1_random:1165458-1165480 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1203083742 16_KI270728v1_random:1166171-1166193 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1142587072 17:980179-980201 GGAGGGGGCGGGATCCCTGGAGG - Intergenic
1142618162 17:1148667-1148689 GGAAGGGTGGGGAGCGCTTTCGG - Intronic
1142805012 17:2366956-2366978 GGATGGGCTGGCAGCCCAGGAGG - Intronic
1142894352 17:2964350-2964372 GGAGGGGCTGGGGGCCCTGGGGG + Intronic
1142991290 17:3732862-3732884 GTCCAGGTGGGGAGCCCTGGTGG - Intronic
1143037235 17:4006367-4006389 GGATGCTTGGGGATCACTGGTGG + Exonic
1143172002 17:4935764-4935786 TGGTGGGTGGCCAGCCCTGGAGG - Intergenic
1143461701 17:7108367-7108389 GGCTGTGTGGGGTGCCGTGGGGG - Intronic
1143480786 17:7226356-7226378 GGATGAGAGGGGAGCCAGGGAGG - Intronic
1144810890 17:17998160-17998182 GGAAGCCTGGGGAGCCTTGGGGG + Intronic
1145270061 17:21400163-21400185 GGTGGGGTGGGGAGCCCTTCAGG - Intronic
1145279186 17:21455819-21455841 GAATGGGTCTGGAGACCTGGGGG + Intergenic
1145308285 17:21687612-21687634 GGTGGGGTGGGGAGCCCTTCAGG - Intergenic
1145398671 17:22514628-22514650 GAATGGGTCTGGAGACCTGGGGG - Intergenic
1146059488 17:29596900-29596922 GGATGGGAGGGGTGACATGGAGG + Intronic
1146122379 17:30207198-30207220 AGAAGGGTGGGGAACCATGGTGG + Intronic
1146628188 17:34449974-34449996 TGATGGGTGGGAATACCTGGAGG - Intergenic
1146659201 17:34653305-34653327 GGATGGGGGGTGAGTCCTGGGGG - Intergenic
1147168783 17:38606338-38606360 GGCTGGGTGGGGAGGCGGGGCGG + Intergenic
1147882889 17:43665352-43665374 GGGTGGGTGGGGAGGTCAGGAGG + Intergenic
1147886876 17:43690445-43690467 GGAGGGGTTGGGGGTCCTGGAGG - Intergenic
1148219744 17:45853042-45853064 AGAAGGGTGAGGTGCCCTGGAGG + Intergenic
1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG + Intronic
1148592218 17:48825004-48825026 GGGTGGGTGGGGGGCGGTGGAGG - Intergenic
1149665245 17:58360704-58360726 GGAGGGGTGGGCAGGCCTAGGGG - Intronic
1149867860 17:60160782-60160804 GGGAAGGTGGGAAGCCCTGGGGG + Intronic
1150086792 17:62277676-62277698 GGGAAGGTGGGAAGCCCTGGGGG - Intronic
1150227072 17:63530050-63530072 GGATGGGGGGTGGGCCCTGAAGG - Intronic
1150510916 17:65752309-65752331 GGATGGGTGGGCATCACTGCAGG + Intronic
1151935143 17:77256795-77256817 GGGTGGGTGGGGCTGCCTGGGGG + Intergenic
1152242973 17:79169712-79169734 GGCTGGGTGGGGAGAACGGGAGG + Intronic
1152404057 17:80086617-80086639 GAAGGGTTGGGGAGCCCCGGTGG - Intronic
1152469563 17:80483172-80483194 GAAGGGGTGGGGAGCCTGGGAGG + Intergenic
1152635585 17:81429366-81429388 GGAGGGGAGGGGATCCCGGGGGG - Intronic
1152727926 17:81956791-81956813 CTGTGGGTGGGGAGCCCCGGGGG - Intronic
1152734781 17:81992034-81992056 GGCCGGGTGGGGAGCTCTGCTGG + Intronic
1152946607 17:83201036-83201058 GGCTGGTTGGGGAGCTCCGGGGG + Intergenic
1153575997 18:6522616-6522638 GGTTGGGTAGGGAGCCTTCGAGG - Intronic
1154495907 18:14960885-14960907 GGATGGGTTGGGAGGCCATGTGG + Intergenic
1154510570 18:15096761-15096783 GACTGGATGGGGAGCTCTGGAGG - Intergenic
1155508256 18:26551046-26551068 GCAGAGGTGGGGAGACCTGGGGG - Intronic
1155785811 18:29898348-29898370 GCATGGATGGGGAGCCCAGCAGG + Intergenic
1156514713 18:37670127-37670149 GGAAGGGTGGGGACTGCTGGAGG - Intergenic
1156526824 18:37775635-37775657 AGGTGGGTGAGGAGCCTTGGAGG + Intergenic
1157574191 18:48732762-48732784 GCATGGCTGGGGAGGGCTGGAGG - Intronic
1157894948 18:51457075-51457097 GGGTGGGTGGGGAGAGCTGAGGG - Intergenic
1158091900 18:53724590-53724612 GGCTGGGTGGGCACCTCTGGAGG + Intergenic
1158282973 18:55848292-55848314 GGATGGGGTGAGAGCCCTGCTGG - Intergenic
1158530613 18:58256534-58256556 GGAAGATCGGGGAGCCCTGGAGG + Intronic
1159704826 18:71674285-71674307 TGAAGGGTGGGGAGCCTTCGGGG - Intergenic
1160374631 18:78402138-78402160 GGAGGGCTGGAGAGGCCTGGAGG + Intergenic
1160541580 18:79626916-79626938 AGGTGGGTGGAGAGCTCTGGAGG - Intergenic
1160700057 19:501823-501845 GGGTGTGTGTGGAGCCCTGCTGG - Exonic
1160742854 19:695321-695343 GCCTGGGTGGGGATCCCGGGGGG + Intronic
1160767894 19:816533-816555 GGATGGATGGGTACCACTGGGGG - Intronic
1161014703 19:1977969-1977991 GGAGGAGTGTGGAGCCCTTGGGG + Intronic
1161165686 19:2785905-2785927 GGATGGGTCGGGCCCCGTGGCGG + Intronic
1161574852 19:5049570-5049592 GGGCGAGTGGGGAGCTCTGGGGG - Intronic
1161972513 19:7590567-7590589 GGATGGGTGGGGGGCCGTCCAGG - Intergenic
1162013324 19:7830700-7830722 GGGGGGATGGGGAGCCCTGAGGG - Intronic
1162030253 19:7914222-7914244 TGTTAAGTGGGGAGCCCTGGGGG + Exonic
1162386712 19:10364586-10364608 TGCTGGGTGGGGGGCGCTGGGGG - Intronic
1162440538 19:10689402-10689424 GGATGGGGGCGGGGGCCTGGAGG - Exonic
1162899342 19:13785312-13785334 GGCTGTTTGGGGAGCCCTGAGGG - Intergenic
1163366802 19:16880025-16880047 GCGGGGGTGGGGAGCCCAGGAGG - Exonic
1163443564 19:17333879-17333901 GGAGTGGTGAGGAGCCCTGGCGG - Intronic
1163675274 19:18652715-18652737 GGATGGGAGGGGTGCTGTGGAGG - Intronic
1163676014 19:18655676-18655698 GGATGGGAGGGGTGCTGTGGAGG + Intronic
1163676261 19:18656729-18656751 GGGTGGGTGGGGAGGCCGCGAGG + Intronic
1164589065 19:29496164-29496186 GGAGGGGTGGGCAGGACTGGAGG + Intergenic
1164609849 19:29624455-29624477 GCAGGGGTGGGGAGCCGTGTGGG + Intergenic
1164760773 19:30726761-30726783 GGATGGGTGGGGAGCGGGGAAGG - Intergenic
1164845025 19:31424630-31424652 AAATGGGTGGGGAGCCCTGGTGG - Intergenic
1165434212 19:35787724-35787746 GGAAGGATGGGGGGCCCAGGGGG - Exonic
1165751953 19:38265387-38265409 GGTTGGGTTGGGTGACCTGGTGG + Intronic
1165806878 19:38585844-38585866 GGATGGAGGGCAAGCCCTGGAGG + Intronic
1166181637 19:41113066-41113088 GGCTGGGTGGAGAGCCCCTGCGG - Intergenic
1166197813 19:41218582-41218604 GGCTGGGTGGGCATCCATGGGGG - Intergenic
1166198161 19:41219857-41219879 GGAGGGCTCTGGAGCCCTGGGGG + Intronic
1166305691 19:41935857-41935879 GGGTGGGGGGGGAGCCTGGGAGG - Intergenic
1166322092 19:42024820-42024842 GAAGGTGTGAGGAGCCCTGGAGG - Intronic
1166918678 19:46213536-46213558 GGGTGGGGAGCGAGCCCTGGTGG - Intergenic
1166997394 19:46726207-46726229 TGCTGGGTGGTGAGCCCCGGAGG + Intronic
1167019443 19:46862499-46862521 GGATGGGTGACCAGCCCGGGAGG - Intergenic
1167278728 19:48554129-48554151 TGATGGCTGCAGAGCCCTGGGGG + Intronic
1167436323 19:49480690-49480712 GGAAGGGTGGTGAGCAGTGGAGG + Intronic
1167454147 19:49589976-49589998 TCATAGGTGGGGAGGCCTGGGGG - Exonic
1167523932 19:49972271-49972293 GGATTGGTGGGGAGCTGCGGAGG + Intergenic
1167571743 19:50292911-50292933 GGAGGGGAGGAGAGCACTGGGGG + Intronic
1167644292 19:50697329-50697351 GGCAGGGTGGGGATGCCTGGGGG - Intronic
1167696035 19:51016041-51016063 GGATGGGGCCTGAGCCCTGGTGG + Exonic
1167713816 19:51128061-51128083 GGAGGGAGGGAGAGCCCTGGGGG + Intronic
1167742199 19:51330270-51330292 GAGGGGGTGGGGGGCCCTGGGGG + Exonic
1168072779 19:53962156-53962178 GGAAGAGTGGGGAGAGCTGGTGG + Intergenic
1168298369 19:55388974-55388996 GGAGGGATGGGGACACCTGGAGG - Intronic
1168609305 19:57786530-57786552 GGATGGCGGGTGAGGCCTGGAGG - Intronic
1202712488 1_KI270714v1_random:25902-25924 AGCTGGGTGGGGAGGCGTGGGGG - Intergenic
926049846 2:9737691-9737713 GGAGGAGTGGGGGGCACTGGGGG - Intergenic
927383542 2:22506642-22506664 GGAGGGATGGAGAGCCATGGTGG + Intergenic
927642195 2:24852433-24852455 GGGTGGGGAGGGAGCCATGGAGG - Intronic
929779738 2:44949873-44949895 GGAGCGGTGGGAAGCCGTGGGGG - Intergenic
932214564 2:69958553-69958575 GGGTGGGTGGGGAGCTGGGGAGG - Intergenic
932399029 2:71466824-71466846 GCATGGCTGGGCAGCCCCGGCGG - Exonic
932777233 2:74535641-74535663 GGATGACTGGGGGACCCTGGAGG - Exonic
933603885 2:84360947-84360969 GGGTGGCTGGGGACCCCTGTTGG - Intergenic
933989670 2:87625220-87625242 GGATGGTAGGGGAGGCTTGGAGG + Intergenic
934299092 2:91766437-91766459 GGAAGGGTATGGAGCCCAGGGGG + Intergenic
934560304 2:95309842-95309864 GGCTGGGTGGTGACCCCAGGAGG - Intronic
934765422 2:96877731-96877753 GGAAGGGTGGGGACGCCTTGAGG - Intronic
935146592 2:100399664-100399686 AGCTGGGTGGGGGGCCCTGAGGG - Intronic
935182538 2:100703845-100703867 GGAGGGATGGGGACCACTGGAGG + Intergenic
935832722 2:107017294-107017316 GGATGGCTGGGGAGGCCTCAGGG + Intergenic
936009778 2:108918182-108918204 GGGTGGGGCGCGAGCCCTGGTGG + Intronic
936278517 2:111119891-111119913 GGATGGGTGGGGAGGCGGGAGGG + Intronic
936304174 2:111325606-111325628 GGATGGTAGGGGAGGCTTGGAGG - Intergenic
937234489 2:120422332-120422354 GGAAGAGTGGGGAGCTTTGGGGG + Intergenic
938213105 2:129485223-129485245 GGCCGTGTGGGAAGCCCTGGTGG + Intergenic
938367345 2:130745147-130745169 TGGTGGGTGAGGAGCCCTGCGGG - Intergenic
938902819 2:135812471-135812493 GGATTCGTGTGGTGCCCTGGGGG - Exonic
939375678 2:141363179-141363201 AAATGGGTGGTGAGACCTGGTGG - Intronic
940867857 2:158835256-158835278 GTGTGTGTGGGTAGCCCTGGAGG + Intronic
941105210 2:161344115-161344137 GGGGGGGTGGGGAGCGGTGGGGG + Intronic
943040257 2:182796168-182796190 GGATGGATGGGTAGACATGGTGG + Intergenic
944060093 2:195563197-195563219 GGAGGGGCGGGGGGCCCTAGGGG - Intergenic
945037571 2:205717209-205717231 TGGTGGGTGGGGAGGACTGGAGG - Intronic
946063780 2:216968549-216968571 GTATGGGGTGGGAGACCTGGGGG + Intergenic
946181473 2:217951654-217951676 GGATGGGGAGTGAGCCCTGAGGG - Intronic
946301097 2:218824467-218824489 GGATGGGTGGGGGGCCTCTGTGG - Intronic
946331163 2:219009892-219009914 GGATGGGTCTGGAGCTCTGATGG + Intronic
946445789 2:219738831-219738853 GGATGGCTGAGTAGGCCTGGAGG + Intergenic
947167387 2:227276435-227276457 GGATGGCCAGGGGGCCCTGGAGG - Exonic
947587140 2:231363352-231363374 GGATGGGCAGGAAGCCCTTGGGG + Intronic
947667870 2:231918581-231918603 GCACGGGTTGGGCGCCCTGGGGG - Intergenic
948117915 2:235507342-235507364 TGATGGCGGGGGAGCGCTGGTGG + Intronic
948147284 2:235717051-235717073 GGCAGTGTGGGGAGACCTGGGGG - Intronic
948439657 2:237978566-237978588 GGCTGAGCGGGGAGCCCTTGCGG - Intronic
948573154 2:238930090-238930112 GGCTGGCAGAGGAGCCCTGGAGG + Intergenic
948809815 2:240468790-240468812 GGGTGGGTGGGCACCCCAGGAGG + Intergenic
1168812002 20:710376-710398 GGCTGGGTGGGGGGGCCGGGGGG - Intergenic
1169076235 20:2761196-2761218 GGATGGGTCAGGTGCCATGGTGG + Intergenic
1171112728 20:22499432-22499454 TGATGTGTGGGGTGGCCTGGAGG - Intergenic
1172594537 20:36141397-36141419 GCATGAATAGGGAGCCCTGGAGG + Intronic
1172608284 20:36230517-36230539 GGAGGGGTGGGGGGCCCTAATGG + Exonic
1172776966 20:37413524-37413546 TGATGGGTGTGGGGCCCAGGAGG - Intergenic
1173479561 20:43388499-43388521 GGGTGGGTGGGGAGCTCTTGAGG - Intergenic
1173681349 20:44884828-44884850 GGAGGGGAGGGGAGCCATGGAGG + Intergenic
1173728317 20:45312046-45312068 AGATAGGTGGGGAGACCGGGAGG + Intronic
1173836244 20:46128145-46128167 GGATCGGCTGAGAGCCCTGGTGG + Exonic
1174102492 20:48138255-48138277 GGAAGGGTGGGTGGACCTGGTGG - Intergenic
1174398151 20:50260697-50260719 GATGGGGTGGGGAGCCCTGTGGG - Intergenic
1175127752 20:56764961-56764983 GGGTGGGTGGGGGGCGGTGGTGG + Intergenic
1175237937 20:57526201-57526223 GGAGGGGAGGAGAGCCCTGCAGG + Intergenic
1175237999 20:57526370-57526392 GGAGGGGAGGAGAGCCCTGTAGG + Intergenic
1175422129 20:58841061-58841083 GGATGCCAGGGGCGCCCTGGTGG + Intronic
1175966845 20:62664206-62664228 GCATGGGCCTGGAGCCCTGGGGG - Intronic
1176215706 20:63946714-63946736 GGGTGGGGGGGGTGCCCTGTGGG - Intronic
1176230072 20:64028049-64028071 GGTGGCGTGGAGAGCCCTGGAGG + Intronic
1176246966 20:64102099-64102121 GGAAGGCTGGGGCGCCCGGGAGG + Intergenic
1176254385 20:64143334-64143356 AGATGGGTGGGGAGACCTCTGGG - Intergenic
1176787298 21:13272649-13272671 GACTGGATGGGGAGCTCTGGAGG + Intergenic
1177986458 21:27981143-27981165 GACTGGATGGGGAGCTCTGGAGG + Intergenic
1178409296 21:32350433-32350455 GAATGGGTTGGCAGCCCTGCCGG - Intronic
1178662941 21:34522122-34522144 TGCTGGGTGGGGAACCCTAGGGG - Intronic
1179177784 21:39021508-39021530 GGGTGGGTGGGCAGGGCTGGTGG + Intergenic
1179495731 21:41770157-41770179 GGCTGGGTGCAGAGGCCTGGCGG - Intergenic
1179606418 21:42518502-42518524 GGATCAGTGGTGAGTCCTGGTGG + Exonic
1179713118 21:43274380-43274402 GGAGGGGAGGGGAGCCCGGGAGG - Intergenic
1179714870 21:43281466-43281488 GGGTGAGTGGGGACCCCCGGGGG + Intergenic
1179905151 21:44418791-44418813 GGCTGGGAGGGAAGCCTTGGCGG + Intronic
1180051720 21:45334738-45334760 GAGTGGGAGTGGAGCCCTGGAGG - Intergenic
1180949138 22:19713443-19713465 GGACGGGTGGGGAGCAGAGGCGG + Intergenic
1181405303 22:22680303-22680325 GGATGCATGGGCAGCTCTGGGGG - Intergenic
1181494348 22:23279573-23279595 GGCTGGTGGGGGGGCCCTGGAGG - Intronic
1182476752 22:30580729-30580751 GTGGGGGTGGGCAGCCCTGGTGG - Intronic
1183648191 22:39138812-39138834 GGATTGGTGGGCAGGCCTGTGGG - Intronic
1183982450 22:41549583-41549605 GAATGGGTGGGATGACCTGGAGG + Intergenic
1184091406 22:42294865-42294887 GGTTGGGTGGAGGGCCCTGGGGG + Intronic
1184362586 22:44027146-44027168 GCTTCTGTGGGGAGCCCTGGGGG - Intronic
1184587366 22:45457062-45457084 GGGTGGGTGCGGGGCCCTGGAGG - Intergenic
1184640587 22:45867992-45868014 GGAGTGGTGGGGGGCCCGGGGGG - Intergenic
1184759809 22:46537792-46537814 GGCTGGGTGGGGAGGCCTCCGGG - Intergenic
1184938218 22:47740395-47740417 GGCTGGGTGAGGAGCTTTGGAGG - Intergenic
1184983856 22:48115692-48115714 GCATGAGGGGAGAGCCCTGGGGG - Intergenic
1185046736 22:48532231-48532253 TGCTGGCTGGGCAGCCCTGGAGG - Intronic
1185128703 22:49025631-49025653 GGATGTGTGGGGAGCCTGGTGGG + Intergenic
1185246799 22:49776993-49777015 GGAGGTGTGGAGAGCCATGGAGG + Intronic
950297523 3:11845015-11845037 GGAAGGGTAGGGAGCCGTGTTGG + Intronic
950414293 3:12859862-12859884 GGATAGGTGGGGACCTCAGGAGG - Intronic
950414574 3:12861605-12861627 GGACAGGTGGGGACCCCAGGAGG - Intronic
950496397 3:13336750-13336772 GGGTGGGAGGTGAGCTCTGGAGG + Intronic
953240456 3:41144221-41144243 GGATGGGTGGGGTGGCATAGGGG - Intergenic
953925547 3:46980639-46980661 AGATGGGTGGGGAGCTCAGGAGG - Intronic
953927513 3:46989920-46989942 GGATGGGTGGAGATGCGTGGAGG - Intronic
954374909 3:50188983-50189005 AGATGGGTGGGGGCTCCTGGTGG + Exonic
954375819 3:50193711-50193733 AGGTGGGTGGGGAGGCGTGGAGG - Intronic
954409671 3:50364975-50364997 GCATGGGTGGGGAGTCAAGGAGG + Intronic
954448238 3:50557954-50557976 GGATGGGTGAGGGGCTGTGGGGG - Intergenic
955077148 3:55624513-55624535 GGATGGGAGAGGTGCCCTGTGGG + Intronic
955485457 3:59430295-59430317 GAAAGGGTGGGGAGTCTTGGGGG + Intergenic
957383651 3:79467614-79467636 GGATGGGTGGTGAGCCCAAAAGG - Intronic
960938812 3:122920324-122920346 GGCTGGGTGGGACTCCCTGGTGG + Intronic
961182320 3:124886842-124886864 GGAGGGGCGGGGAGCGCAGGCGG - Intronic
961434132 3:126904909-126904931 GGAAGGGTGGGGTGCCCTGGTGG + Intronic
961778311 3:129305895-129305917 GGAGGGGTGGGGAGCCAGGTGGG + Exonic
963669324 3:148231859-148231881 GGGTGGGTGGGGTGGCATGGGGG + Intergenic
964339831 3:155696963-155696985 GGATGTATGGGAAGCCCAGGTGG - Intronic
964790426 3:160449609-160449631 TGTTGGGCGGGGAGTCCTGGGGG - Intronic
965342903 3:167512070-167512092 GAATGGGTGTGCTGCCCTGGCGG - Intronic
965477878 3:169179899-169179921 GGACTGATGGGGAGTCCTGGGGG - Intronic
965688559 3:171331115-171331137 TGCTGGGTGGGAAGCACTGGGGG + Intronic
965907216 3:173724036-173724058 AGATGGGTAGGGATCCATGGGGG + Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967137057 3:186521500-186521522 GTCTGTGTGGGCAGCCCTGGGGG + Intergenic
967310783 3:188104147-188104169 TGCCGGATGGGGAGCCCTGGAGG - Intergenic
967685145 3:192409415-192409437 GGAAGGAAGGGGCGCCCTGGCGG + Intronic
967829916 3:193909891-193909913 GGGAGAGTGGGGTGCCCTGGTGG + Intergenic
968486699 4:866389-866411 GGATGGGGGCGGAGCACTGTGGG + Exonic
968509220 4:987999-988021 AGATGGGAGGGGAGGGCTGGGGG + Exonic
968575680 4:1364947-1364969 GGAAGGATGGTGCGCCCTGGGGG + Intronic
968581986 4:1399448-1399470 GCATGGGTGGGGAGCACAGGGGG + Intergenic
968761162 4:2443246-2443268 GGCTGGATGGGGGGCTCTGGGGG + Intronic
968807905 4:2787233-2787255 TGATAGGTGGGGACCCCTTGGGG + Intergenic
968903270 4:3440828-3440850 GGAGGCGTGGTGGGCCCTGGGGG - Intergenic
968959408 4:3735320-3735342 GGATGGGCCTGGAGCTCTGGAGG + Intergenic
968995236 4:3941233-3941255 GGGTGCGAGGGGAGCCCAGGTGG + Intergenic
969202403 4:5616384-5616406 GAATGGTCTGGGAGCCCTGGGGG + Intronic
969296152 4:6271544-6271566 GGAGGGGAGGGGAGCCGTGTAGG - Intronic
969306109 4:6327194-6327216 CAATGGGTGGGGTGCCCTGGGGG - Intronic
969509620 4:7610391-7610413 GGGTGGGCTGGGGGCCCTGGTGG - Intronic
969525041 4:7700047-7700069 GGCTGGGGCGGGAGCCCTGGGGG - Intronic
969690679 4:8702480-8702502 GGACAGGTGGGGACCCCAGGAGG + Intergenic
969850002 4:9948570-9948592 GGAGGGCTGGGTAGCCTTGGTGG - Intronic
970515967 4:16830411-16830433 GCATGGCTGGGGAGGCCTTGGGG - Intronic
971004285 4:22356737-22356759 AGGGGTGTGGGGAGCCCTGGGGG - Intronic
975321944 4:73018748-73018770 AGATTGATGGGCAGCCCTGGTGG + Intergenic
976379548 4:84383730-84383752 GTAGGGGTAGGGGGCCCTGGGGG - Intergenic
976528998 4:86128548-86128570 GGATGGCTGGGGAGGCCTTCAGG - Intronic
976858242 4:89629929-89629951 GGAGGGGTGGGCAGCCATGTGGG + Intergenic
977908957 4:102509970-102509992 GGATGGTTGGGGAACACCGGAGG - Intronic
979158524 4:117429257-117429279 GGCTGGCTGGGGACCCCTGCTGG + Intergenic
983527454 4:168773767-168773789 AGGTGGGTGGGGAGGCCGGGTGG - Intronic
984714857 4:182916733-182916755 GGAGGGAGGGGGAGCCATGGGGG + Intronic
984924597 4:184795623-184795645 GGTTGGGTGGGGTGGCCTGCAGG - Intronic
985575895 5:673402-673424 GGAGGTGGGGGCAGCCCTGGGGG + Intronic
985721737 5:1493148-1493170 GGCTGGCTGGGGAAGCCTGGAGG - Intronic
986728767 5:10619485-10619507 TGATGGGTGGGGGGCCAGGGAGG + Intronic
988776522 5:34482309-34482331 GGATGGGTGGGGAGCTGGGAAGG - Intergenic
989667633 5:43874613-43874635 GGATGGGTGGGGACCAGAGGCGG + Intergenic
990621280 5:57562083-57562105 GGGTGGGTGGGGAACATTGGAGG - Intergenic
990923519 5:60994048-60994070 GCATGGGAGGGAAGCCGTGGGGG - Intronic
991704447 5:69344787-69344809 GCATGGCTGGGGAGGCCTGAGGG - Intergenic
992076739 5:73198789-73198811 GACTGGGTGGGGAGCCCAGAAGG + Intergenic
992157381 5:73968701-73968723 GGCTGGGTGAGGAGCCTTAGGGG + Intergenic
995869644 5:116730969-116730991 CCAAAGGTGGGGAGCCCTGGAGG - Intergenic
997475861 5:134142178-134142200 GGATGGGTGGGTGAACCTGGAGG - Exonic
997850961 5:137332178-137332200 GGAAGGGTGGGGATCCCAGGAGG - Intronic
998130822 5:139650293-139650315 GGATGGGGGGGGAGCTAAGGGGG + Intronic
998407168 5:141880419-141880441 GGATGGTTGGGGAGCAAGGGAGG + Intergenic
999258472 5:150222927-150222949 GGATGGGAGTGTTGCCCTGGAGG - Intronic
1000105365 5:158054089-158054111 GGTTGGGTGGGGGGACCTGGAGG - Intergenic
1000328231 5:160188168-160188190 AGAGGGGCGGGAAGCCCTGGTGG + Intronic
1001318362 5:170660723-170660745 GGAGGGTTGGGGAGCCCCGCTGG - Intronic
1001378209 5:171282964-171282986 GGGTGGATGGGGAGTACTGGTGG - Intronic
1001476369 5:172054010-172054032 GGAGAGGTGGGGAGGCATGGAGG - Intronic
1001548766 5:172587135-172587157 GGCTGGGTGGCGAGGGCTGGAGG - Intergenic
1002028722 5:176413132-176413154 GGGTGGGTGGAGAGCACTGTGGG - Intronic
1002070623 5:176677148-176677170 GGAAGTGGGGGCAGCCCTGGGGG - Intergenic
1002081432 5:176739895-176739917 AGATGGCTGGGGAGCCCCTGCGG - Intergenic
1002306395 5:178286361-178286383 GGATGTGTGTGGAGCCCCGCGGG - Intronic
1002542058 5:179912973-179912995 GGATGGGTGGGGAACTGAGGAGG + Intronic
1002633626 5:180596553-180596575 GGACCGGTGGGCAGCCCTGGTGG + Intergenic
1003058467 6:2843205-2843227 GGATGTGTTGGGGACCCTGGGGG - Intergenic
1003091294 6:3105829-3105851 GGTTGGCTGGTGAGCCCTGAGGG - Exonic
1003173669 6:3739243-3739265 CTATGTCTGGGGAGCCCTGGTGG - Intronic
1003264410 6:4552746-4552768 GGTAGGGTGTGGAGCCGTGGTGG - Intergenic
1003868644 6:10384718-10384740 GGAAGGAGGGGGAGCCGTGGCGG + Intergenic
1004727823 6:18327680-18327702 GGGAGAGTGGGGAGCCCAGGGGG + Intergenic
1004733810 6:18384855-18384877 GCATGGCTGGGGAGCCCTCAGGG - Intergenic
1004850498 6:19693699-19693721 GGATGGGTGGGGAGACAAAGAGG + Intergenic
1005399403 6:25415984-25416006 GGAGGGGTGGGGAGCCAGTGAGG + Intronic
1006010753 6:31041114-31041136 GGAAGGGCCGGGAGCCCAGGTGG - Intergenic
1006165590 6:32062499-32062521 GAATGGGTGGGCATGCCTGGTGG + Intronic
1006193339 6:32222681-32222703 GGAGAGCTGGGGAGCCCTAGGGG + Exonic
1006511728 6:34525301-34525323 GGACAGATGGGGAGCCCTAGGGG + Intronic
1006833918 6:36985687-36985709 GGATGGGAGGGAAGCCGTGAGGG - Intronic
1006836850 6:37004300-37004322 GGTTCAGTGGAGAGCCCTGGTGG + Intergenic
1007074211 6:39056516-39056538 GGTTGGGTGGGGAGCACTAAAGG - Intronic
1007085418 6:39141000-39141022 GGATGGGGGCGGAGTCCCGGAGG + Intergenic
1007595375 6:43047884-43047906 GGGTGTGTGGGGGACCCTGGGGG + Intronic
1007904544 6:45445834-45445856 GGATGGGTCAGAAGCGCTGGTGG + Intronic
1008389799 6:50936808-50936830 GGATGGGAGGGGAGCACAGAAGG + Intergenic
1008912965 6:56756359-56756381 AGATGGGTGTGGAGCACTAGTGG + Intronic
1013284043 6:108664929-108664951 GGATGAGGGGGGATCTCTGGGGG + Intronic
1015625359 6:135176005-135176027 GGCTGGGTGGAGAGACCTGTTGG - Intergenic
1017156410 6:151325968-151325990 CGTTTGGTGGGGAGCCCGGGAGG + Intronic
1018325319 6:162661503-162661525 GGTTGGTTTGGGAGACCTGGCGG + Intronic
1018754549 6:166837697-166837719 TGAAGGGTGGGGAGCCCGGGAGG - Intronic
1019278990 7:190997-191019 GGGTGTGGGGGGAGTCCTGGGGG - Intergenic
1019375833 7:691482-691504 GGATGGCTGTGGTGCGCTGGGGG - Intronic
1019487431 7:1295868-1295890 GGCTGGGTGGGTGGCCCAGGGGG - Intergenic
1019526574 7:1483131-1483153 GGGTGGGTGGTGACCCCTGTTGG - Intronic
1019599303 7:1873455-1873477 GGGCAGGTGGGGAGCCCTGGTGG + Intronic
1019635379 7:2072807-2072829 GGATGGCTGGGCAGCCTTGAAGG + Intronic
1019706618 7:2500014-2500036 GGGTGGGTGGGGTGGCCAGGGGG - Intergenic
1022483398 7:30759087-30759109 AGCCGGGTGGGGAGACCTGGTGG - Intronic
1023837940 7:44079518-44079540 GGGTGGGTGGGGAGGCCTTGGGG - Intronic
1023842688 7:44105968-44105990 GGAAGGATAGGGAGTCCTGGGGG - Intronic
1023869005 7:44252663-44252685 GGATGGGTGGAGTGCCCTGAGGG - Intronic
1025250178 7:57346638-57346660 AGAGGGGTGAGAAGCCCTGGAGG + Intergenic
1025854756 7:65267216-65267238 GGATGGGTGAGGGGCTTTGGGGG + Intergenic
1026665220 7:72336014-72336036 GGATGGGTCTGGCGCCCAGGTGG - Intronic
1026678324 7:72446837-72446859 GGAGGGGTAGGGAGATCTGGAGG - Intronic
1026737880 7:72960409-72960431 CCATGCATGGGGAGCCCTGGCGG + Intronic
1026788915 7:73319210-73319232 CCATGCATGGGGAGCCCTGGCGG + Intronic
1026839108 7:73659006-73659028 GGCTGGGTGGGCAGGCTTGGGGG + Intergenic
1026916346 7:74122153-74122175 GGAGGGGCAGGGAGCCTTGGGGG - Exonic
1027105854 7:75404659-75404681 CCATGCATGGGGAGCCCTGGCGG - Intronic
1027232743 7:76281972-76281994 GGAGGGGTTGGGATCCGTGGGGG - Intronic
1029124668 7:98287862-98287884 GTGTGGGTGGGGAGCCCGGCTGG - Intronic
1029519590 7:101051716-101051738 GGAGAGGTGGGGAGCCCAGGAGG + Intronic
1029596256 7:101538938-101538960 GGGTGGGTGGAGATCCCTGCTGG - Intronic
1030116503 7:106065704-106065726 GGATGGGGGGGGGCGCCTGGAGG + Intergenic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1032000892 7:128264810-128264832 GGTTGGGTGAGGAGCTCTGCGGG - Intergenic
1032197964 7:129800056-129800078 GTGTGGGTGGGGAGCTCTGCGGG + Intergenic
1033049285 7:137989509-137989531 GGCTGAGTGTGGAGCCCTGGGGG - Intronic
1033360895 7:140638506-140638528 TGTTGGGTGGGGAGGCCTGGAGG - Intronic
1033640972 7:143263300-143263322 GGGTGGGTAGGGACCCCTTGGGG - Intronic
1035252077 7:157604143-157604165 TGCTGGGTGGGGGGCCCTGGAGG - Intronic
1035465137 7:159070051-159070073 TGCTGAGTGGGCAGCCCTGGAGG - Intronic
1035920270 8:3668711-3668733 GGATGAGTTGGGAGCTCAGGAGG + Intronic
1036149384 8:6283706-6283728 GGAAGGGTGAAGAGCCCTGCAGG - Intergenic
1036646018 8:10611755-10611777 GGATGTGTGGGGAGGTATGGGGG + Exonic
1036751599 8:11447006-11447028 ACATGGATGAGGAGCCCTGGTGG + Intronic
1037836891 8:22219905-22219927 GGATGAGTCAGGAGGCCTGGAGG - Exonic
1037920517 8:22802294-22802316 GGATGGGTGGGAAGGCCCAGGGG - Intronic
1037988680 8:23305518-23305540 GAATGGGTGGGTAGTGCTGGTGG - Intronic
1038481097 8:27902315-27902337 GGATGGGTGGGGAGGCGTGGGGG - Intronic
1039442851 8:37607552-37607574 GGGTGGGTTGCGAGCCCAGGGGG - Intergenic
1039469309 8:37803579-37803601 GGAAGGATGGGGGCCCCTGGAGG - Intronic
1040006048 8:42621687-42621709 TGCTGGGTGAGGAGGCCTGGAGG + Intergenic
1040464983 8:47686111-47686133 AGCTGGGTGGGGAGCCATGGTGG - Intronic
1042871143 8:73400810-73400832 GGTTGTGTGGAGAGCCCAGGAGG - Intergenic
1044277516 8:90319740-90319762 GGATGGGTGGGGGGGCTGGGTGG - Intergenic
1044638173 8:94349543-94349565 GCATGGCTGGGGAGGCCTTGAGG + Intergenic
1045647823 8:104316553-104316575 GCATGGGTGGGGAGCACAGGTGG + Intergenic
1048277811 8:133080489-133080511 GGATGGGAAGGGAGCATTGGCGG - Intronic
1048282657 8:133116500-133116522 GGGTGGGTTGGGGGCCCAGGGGG + Intronic
1049246787 8:141567171-141567193 TGATGGAAGGGGAGCCCTGAGGG + Intergenic
1049358262 8:142199363-142199385 GGAAGTGTGGGCAGCCCAGGGGG - Intergenic
1049520791 8:143089152-143089174 GCACAGGTGGGGAGCTCTGGGGG + Intergenic
1049531800 8:143158979-143159001 GGATGGGTGGGGGGCGCAGGGGG - Intronic
1049616004 8:143576029-143576051 GGGTGGCTGGGGGGCTCTGGGGG - Intronic
1049697698 8:143991618-143991640 GGAGGGGTGGGGTGGCCGGGAGG + Intronic
1050101850 9:2128113-2128135 GGATGGGATGGGAGCCCCCGGGG - Intronic
1050833015 9:10037474-10037496 GCATGGCTGGGGAGCCCTCAGGG - Intronic
1050873985 9:10612922-10612944 GGCTGGGCGGGGAGCCGAGGCGG + Intergenic
1051687104 9:19669289-19669311 GGTTGGGTGGGGAGTGGTGGTGG + Intronic
1052993988 9:34539900-34539922 TGAAAGGTGGGGAGCCCCGGGGG + Intergenic
1053287544 9:36859589-36859611 GGAAGGGTGAGGAGCCGGGGAGG - Intronic
1053316748 9:37058638-37058660 GGATGTGTGGGGAGCTAGGGGGG - Intergenic
1053605914 9:39658444-39658466 AGGGAGGTGGGGAGCCCTGGGGG + Intergenic
1053863832 9:42415068-42415090 AGGGAGGTGGGGAGCCCTGGGGG + Intergenic
1054247632 9:62683972-62683994 AGGGAGGTGGGGAGCCCTGGGGG - Intergenic
1054561747 9:66718497-66718519 AGGGAGGTGGGGAGCCCTGGGGG - Intergenic
1054713077 9:68530703-68530725 GGGAGGGTGGGGACCCCTGCCGG + Exonic
1056762006 9:89422395-89422417 GGACGGTTGGGGGGCCCTGCTGG + Intronic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1057264384 9:93604259-93604281 GGGTGTGGGAGGAGCCCTGGAGG + Intronic
1057457567 9:95228192-95228214 AGATGGGAGGGGAGCCAGGGCGG + Intronic
1058851239 9:109013570-109013592 GGTTGGCGGCGGAGCCCTGGGGG - Intergenic
1059439561 9:114299374-114299396 GGAGGGCTGGGGGCCCCTGGAGG - Intronic
1059443520 9:114324153-114324175 GGCTGGATGTAGAGCCCTGGAGG + Intronic
1059444711 9:114330927-114330949 GGCTGGATGTAGAGCCCTGGAGG + Intronic
1059526819 9:114999894-114999916 GGAGGGGTGGGAAGCTGTGGAGG - Intergenic
1060048374 9:120358994-120359016 GGATGAGTGAGGTACCCTGGTGG + Intergenic
1060660629 9:125403166-125403188 GGTTGGGTGAGGATTCCTGGGGG + Intergenic
1060816571 9:126638343-126638365 GGAGTCCTGGGGAGCCCTGGAGG - Intronic
1060945607 9:127568264-127568286 GGATCGATGGGGCGCCCCGGAGG - Intronic
1061147492 9:128808479-128808501 GGAGGGGCTGGGAGACCTGGAGG - Exonic
1061407053 9:130398299-130398321 TGATGGGAGTGGAGGCCTGGAGG + Intronic
1061521383 9:131120328-131120350 GGAAGGCTGGGGAGTCCAGGCGG - Exonic
1061674293 9:132207027-132207049 GGAGGCTTGGGGAGCCCTGCAGG + Intronic
1061726104 9:132582754-132582776 GGGTGGGTGGGGAGCTTTTGGGG + Exonic
1061793793 9:133071806-133071828 AGATGGGAGGGGAGCCCCTGGGG - Exonic
1061796225 9:133087302-133087324 AGATGGGAGGGGAGCCCCTGGGG - Intronic
1061908937 9:133712744-133712766 ACATGGGTGGGGGACCCTGGGGG - Intronic
1061937486 9:133866159-133866181 GGGTGGGTGGGGAGCCAAGCTGG + Intronic
1062122791 9:134842601-134842623 GGATGGGTCGGGCGAGCTGGGGG - Exonic
1062216975 9:135394490-135394512 GGAGGGGTGGGGCTTCCTGGAGG - Intergenic
1062261792 9:135666595-135666617 GGAAGGGAAGGGGGCCCTGGGGG - Intergenic
1062269258 9:135701212-135701234 GGGTGGGTGGGGAACACTCGGGG - Intergenic
1062392692 9:136340262-136340284 GGCCGGGTGGGGAGGCCTGCAGG + Intronic
1062446558 9:136597714-136597736 GGAAGGGTGGAGGGCCCAGGTGG + Intergenic
1062612230 9:137380409-137380431 GGATTGGGGGGGACGCCTGGAGG - Intronic
1062643050 9:137531503-137531525 GCAAGTGTGGGGAGCCCTCGGGG - Intronic
1203362303 Un_KI270442v1:228077-228099 GGATGGGTGGGGTGGGGTGGGGG - Intergenic
1186445194 X:9621168-9621190 GGATAGGTGAGGAGCTATGGAGG + Intronic
1186892711 X:13975165-13975187 GAATGGCTAGGGAGCTCTGGGGG + Intergenic
1188074926 X:25763672-25763694 GGCTGGGTGGGGAGAGCTTGAGG + Intergenic
1189472833 X:41327525-41327547 AGATGGGTGGGGAACCATGGAGG + Intergenic
1190702593 X:52999701-52999723 TGGTGGAAGGGGAGCCCTGGTGG - Intergenic
1192173896 X:68874212-68874234 GGCTGTGTGGAGAGCCCTTGGGG + Intergenic
1192347961 X:70327526-70327548 GGGAGGTTGGGGAGCCCTTGTGG + Intronic
1192438401 X:71156684-71156706 GGAAGTGTGGGGAGACTTGGGGG - Intronic
1195572818 X:106415483-106415505 GGATTGCTGAGGACCCCTGGTGG - Intergenic
1196999180 X:121419573-121419595 AGATGGCTGGGGACCCCTGTTGG - Intergenic
1197953453 X:131922035-131922057 GCATGGCTGGGGAGCCCTCAGGG - Intergenic
1199018688 X:142848986-142849008 GGAGGGGTGGGGAGCAGGGGAGG + Intergenic
1199383637 X:147199256-147199278 GGATGAAAGGGGAGCACTGGGGG - Intergenic
1200036391 X:153334307-153334329 GGATGTGCGGGGGGCGCTGGAGG + Intronic
1200134806 X:153869755-153869777 GGGAGTGTGGCGAGCCCTGGGGG - Intronic