ID: 1148228992

View in Genome Browser
Species Human (GRCh38)
Location 17:45919454-45919476
Sequence CGCCAGGCCGGATCCACGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 14}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148228980_1148228992 18 Left 1148228980 17:45919413-45919435 CCCCTTACCTGCCCCTACTCTGT 0: 1
1: 0
2: 3
3: 28
4: 364
Right 1148228992 17:45919454-45919476 CGCCAGGCCGGATCCACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 14
1148228981_1148228992 17 Left 1148228981 17:45919414-45919436 CCCTTACCTGCCCCTACTCTGTG 0: 1
1: 0
2: 0
3: 29
4: 286
Right 1148228992 17:45919454-45919476 CGCCAGGCCGGATCCACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 14
1148228978_1148228992 23 Left 1148228978 17:45919408-45919430 CCCAGCCCCTTACCTGCCCCTAC 0: 1
1: 0
2: 2
3: 40
4: 437
Right 1148228992 17:45919454-45919476 CGCCAGGCCGGATCCACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 14
1148228985_1148228992 7 Left 1148228985 17:45919424-45919446 CCCCTACTCTGTGGAGAACCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1148228992 17:45919454-45919476 CGCCAGGCCGGATCCACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 14
1148228977_1148228992 29 Left 1148228977 17:45919402-45919424 CCTCATCCCAGCCCCTTACCTGC 0: 1
1: 0
2: 4
3: 74
4: 680
Right 1148228992 17:45919454-45919476 CGCCAGGCCGGATCCACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 14
1148228979_1148228992 22 Left 1148228979 17:45919409-45919431 CCAGCCCCTTACCTGCCCCTACT 0: 1
1: 0
2: 3
3: 49
4: 511
Right 1148228992 17:45919454-45919476 CGCCAGGCCGGATCCACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 14
1148228988_1148228992 5 Left 1148228988 17:45919426-45919448 CCTACTCTGTGGAGAACCGTGGT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1148228992 17:45919454-45919476 CGCCAGGCCGGATCCACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 14
1148228982_1148228992 16 Left 1148228982 17:45919415-45919437 CCTTACCTGCCCCTACTCTGTGG 0: 1
1: 0
2: 2
3: 21
4: 296
Right 1148228992 17:45919454-45919476 CGCCAGGCCGGATCCACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 14
1148228984_1148228992 11 Left 1148228984 17:45919420-45919442 CCTGCCCCTACTCTGTGGAGAAC 0: 1
1: 0
2: 0
3: 8
4: 178
Right 1148228992 17:45919454-45919476 CGCCAGGCCGGATCCACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 14
1148228986_1148228992 6 Left 1148228986 17:45919425-45919447 CCCTACTCTGTGGAGAACCGTGG 0: 1
1: 0
2: 0
3: 9
4: 67
Right 1148228992 17:45919454-45919476 CGCCAGGCCGGATCCACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148228992 Original CRISPR CGCCAGGCCGGATCCACGAA CGG Intronic
903578306 1:24352810-24352832 CTCCAGGCAGGACCCAAGAAAGG + Intronic
912384082 1:109262716-109262738 CGCCAGGCCAGAGACACGAACGG - Intronic
1076907773 10:133372154-133372176 CGCCATGCAAGATCCAGGAAAGG + Intronic
1093722475 12:22460950-22460972 CACCAGGTGGGGTCCACGAATGG + Intronic
1142154585 16:88527312-88527334 CGTCAGGCTGGCTCCAGGAACGG + Intronic
1148228992 17:45919454-45919476 CGCCAGGCCGGATCCACGAACGG + Intronic
1161125954 19:2557530-2557552 CGCCTGGCCGGGTCAGCGAATGG + Intronic
1165069306 19:33246738-33246760 CCCCAGGCAGGCTCCAGGAATGG + Intergenic
925918702 2:8624979-8625001 CGCCCGGCCGGGTCCAGCAATGG + Intergenic
927508294 2:23628698-23628720 GGCCAGGCCCCATCCACAAATGG + Intronic
1176146909 20:63569570-63569592 CGCCAGGCCGGCTCTACGCACGG - Exonic
957959161 3:87227367-87227389 CGCCAGGCAGGACCCGCGGAAGG - Exonic
976132184 4:81896381-81896403 CCCCAGCCCAGATCCAAGAAGGG + Intronic
997392591 5:133529071-133529093 TGTCAGCCTGGATCCACGAATGG + Intronic
1047817971 8:128485527-128485549 CGCCAGGCTGGAACCAGAAAGGG - Intergenic
1061326725 9:129868804-129868826 AGCCAGGCCAGCTCCACGAGTGG - Intronic
1194935186 X:99939597-99939619 CGCGAGGCAGGATCCAAGCAGGG + Intergenic