ID: 1148229118

View in Genome Browser
Species Human (GRCh38)
Location 17:45920229-45920251
Sequence CCAGGTGACAGGAGGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 532}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148229118_1148229126 9 Left 1148229118 17:45920229-45920251 CCCTCTGTCCTCCTGTCACCTGG 0: 1
1: 0
2: 1
3: 54
4: 532
Right 1148229126 17:45920261-45920283 GGCAATGTTGACCAGCTGCCTGG 0: 1
1: 0
2: 1
3: 7
4: 136
1148229118_1148229127 13 Left 1148229118 17:45920229-45920251 CCCTCTGTCCTCCTGTCACCTGG 0: 1
1: 0
2: 1
3: 54
4: 532
Right 1148229127 17:45920265-45920287 ATGTTGACCAGCTGCCTGGCTGG 0: 1
1: 0
2: 1
3: 19
4: 165
1148229118_1148229128 19 Left 1148229118 17:45920229-45920251 CCCTCTGTCCTCCTGTCACCTGG 0: 1
1: 0
2: 1
3: 54
4: 532
Right 1148229128 17:45920271-45920293 ACCAGCTGCCTGGCTGGAGTTGG 0: 1
1: 0
2: 1
3: 32
4: 308
1148229118_1148229130 25 Left 1148229118 17:45920229-45920251 CCCTCTGTCCTCCTGTCACCTGG 0: 1
1: 0
2: 1
3: 54
4: 532
Right 1148229130 17:45920277-45920299 TGCCTGGCTGGAGTTGGCAGTGG 0: 1
1: 0
2: 3
3: 55
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148229118 Original CRISPR CCAGGTGACAGGAGGACAGA GGG (reversed) Intronic
900124833 1:1064736-1064758 CCATGTGCCAGGAGGACACACGG - Intergenic
900691650 1:3984210-3984232 CAAGGGGACAGGAGCACAGGCGG - Intergenic
900871328 1:5305702-5305724 CCAGGTGTCAGGAGAACTGATGG + Intergenic
901626988 1:10630158-10630180 CCAGGCGAGAGGAGGCCAGGTGG - Exonic
901945808 1:12702629-12702651 GCAGGTGGAGGGAGGACAGAGGG - Intergenic
901985046 1:13068784-13068806 CCAGCTGACTGTAGGTCAGATGG - Intronic
901985308 1:13070937-13070959 CCAGCTGACTGTAGGTCAGATGG - Intronic
901996502 1:13155832-13155854 CCAGCTGACTGTAGGTCAGATGG + Intergenic
901996764 1:13157986-13158008 CCAGCTGACTGTAGGTCAGATGG + Intergenic
902248536 1:15138080-15138102 CCAGCAGCCAGGAGGACACAGGG + Intergenic
902349942 1:15847280-15847302 CCAGGTGAGCGGAGGACGAAGGG + Intergenic
902601515 1:17542901-17542923 CCGGGTGACAGGAATACAAAAGG - Intronic
902716379 1:18275742-18275764 GCAGGAGACAGGAAGCCAGATGG + Intronic
903647201 1:24902659-24902681 CGAGGTGCCTGGAGGACAGCAGG + Exonic
905031044 1:34884924-34884946 CTGGGAGACAGGAGGAGAGAGGG - Intronic
905478831 1:38247488-38247510 GCTGGTGACCGGAGGCCAGAGGG - Intergenic
905582990 1:39096242-39096264 ACAGGTGAAAGGAGGGCAGGAGG + Intronic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
907243802 1:53094675-53094697 CCAGGCGGCAGGAAGACAGGCGG - Intronic
907257622 1:53191717-53191739 CTAGGGGACATGAGGACAGATGG + Intergenic
907286267 1:53382260-53382282 CCAGGAGACAGGAGCAGAGGTGG + Intergenic
907365881 1:53959367-53959389 CCAGCAAAGAGGAGGACAGATGG + Intronic
909119171 1:71579209-71579231 CCATGTGACTGGAACACAGAGGG - Intronic
909339713 1:74518079-74518101 GCAGGTTACTAGAGGACAGATGG + Intronic
909426710 1:75534032-75534054 CCAGTTGGCAGGAGGACTCAGGG - Intronic
910944287 1:92572450-92572472 GCAGATGATAGGAGGAAAGAGGG - Intronic
911236020 1:95413233-95413255 GCAGGAGACAGAAGGGCAGAAGG - Intergenic
911794513 1:102058946-102058968 CAAGCTGACAGGGGCACAGATGG + Intergenic
912380097 1:109242761-109242783 CCAGGAAACAGGAGGAAACAAGG - Intergenic
912411403 1:109483239-109483261 CATGATGACAGGATGACAGAAGG - Intergenic
912455495 1:109793927-109793949 CCAGGTTAGAGCAGGACAGAAGG - Intergenic
912468471 1:109890335-109890357 CCAAGTCACAGTGGGACAGAAGG + Intergenic
912488457 1:110047669-110047691 GCAGGTGGCAGGAGGACGGCAGG - Intronic
913161770 1:116151901-116151923 GCAGGAGAGAGGAGGAGAGAAGG - Intergenic
913217392 1:116631768-116631790 CCAGCCCACAGGAGGACATAGGG + Intronic
913244054 1:116856040-116856062 CCAGCTGGCAGGAGGAGAGAGGG - Intergenic
914460512 1:147878966-147878988 CAAGATGCCTGGAGGACAGAGGG + Intergenic
915083202 1:153366125-153366147 ACAGAGGACAGGAGGGCAGAAGG - Intergenic
915570496 1:156742940-156742962 GCAGGGGACAGGAGCTCAGAAGG + Intronic
915724375 1:158007337-158007359 CCAGGTGGAAGGAGGACACCAGG + Intronic
915905186 1:159872185-159872207 CCAGGAGACACCAGGACAAAGGG + Intronic
915907801 1:159891701-159891723 CCAGGTGGCAGCAGCACACAGGG - Intronic
916577990 1:166084017-166084039 CAAGGTAACAGGAGGGTAGATGG + Intronic
917754849 1:178088872-178088894 TGAGGTGAGAGGAAGACAGATGG + Intergenic
918118125 1:181514534-181514556 GCAGGTGTCAGGAAGACAAAGGG - Intronic
919621384 1:199867827-199867849 CCAAGTGAGAGGAAGAGAGAAGG + Intergenic
920808937 1:209264223-209264245 GCAGGTGAGAGGAGGACAGGAGG - Intergenic
920851610 1:209631897-209631919 CCTAGTGACAGGGGGACAGGAGG - Intronic
921191253 1:212710696-212710718 CCAGATGAAAGGAGGAAGGAAGG - Intergenic
921238825 1:213155273-213155295 ACAGTGGACAGGAGGACACATGG - Intronic
921390046 1:214607309-214607331 CAAAGTGGCAGCAGGACAGATGG + Intronic
921714115 1:218400922-218400944 ACAGGTGACAGGAGGTGGGATGG + Intronic
922219888 1:223550418-223550440 CCAGCCCACAGGAGGACACAGGG - Intronic
922272612 1:224048012-224048034 CCGGGAGTTAGGAGGACAGAGGG + Intergenic
922892768 1:229074292-229074314 CCAGCCCACAGGAGGGCAGAGGG + Intergenic
923289684 1:232532164-232532186 CCAAGTGGCAGCAGTACAGATGG + Intronic
923503338 1:234584483-234584505 CCAGGGGAGAGAAGGAAAGAAGG + Intergenic
923553827 1:234985316-234985338 CCAGGGGACACCAGGACAAATGG - Intergenic
923620743 1:235577247-235577269 CCAGGTGAGAGCACGGCAGATGG - Intronic
924310843 1:242741778-242741800 GGAGGTGATTGGAGGACAGAAGG - Intergenic
1063042118 10:2353026-2353048 CCAGTTCACAGTAGGATAGATGG - Intergenic
1063069530 10:2647366-2647388 ACAGATGAAAGGATGACAGATGG - Intergenic
1063703043 10:8404170-8404192 GCAGGGGGCAGGAGGACAGGAGG + Intergenic
1064266513 10:13829820-13829842 GCAGGTGACAGAAGCAAAGATGG - Intronic
1064349763 10:14566280-14566302 GCAGGTGACAGGTGAACAGTAGG - Intronic
1065053720 10:21821197-21821219 GCAGGTGAAAGGAGGGCAGGAGG + Intronic
1065154089 10:22852002-22852024 CAGGTTGACAGGTGGACAGATGG + Intergenic
1066044338 10:31582897-31582919 CCAGGTGACAGGAGCAGGGAAGG - Intergenic
1066236040 10:33485680-33485702 CCAGGTCAAAGAAAGACAGAGGG + Intergenic
1067107346 10:43374933-43374955 CCAGGGGAGAGGAGGAGAGGAGG - Intronic
1068393964 10:56437116-56437138 TTAGGGGACAGAAGGACAGAAGG + Intergenic
1068839010 10:61589385-61589407 CCAGGAGACAGGAAGAGAGATGG + Intergenic
1070697521 10:78573901-78573923 CCAGGGGATGGGAGGACACAGGG + Intergenic
1070915954 10:80154824-80154846 CCAGGTCCCAGGAGGGAAGAAGG - Exonic
1071997187 10:91160975-91160997 CCAGTGGACAAGATGACAGAGGG - Intergenic
1072189147 10:93066369-93066391 CCAGGTGGGAGGAGGGCGGAGGG + Intronic
1072415721 10:95245288-95245310 CCAGGTGACAGGGAGGAAGAAGG - Intronic
1072650832 10:97293912-97293934 CCAGGTGGCAGGATATCAGAAGG - Intergenic
1072805705 10:98422995-98423017 GCAGGTGAAAGGATGCCAGAGGG - Intronic
1072933385 10:99687893-99687915 CCAAGCGGTAGGAGGACAGAGGG + Intronic
1073109267 10:101051045-101051067 CCAGGTGGCAGGAGATCAGGAGG - Intergenic
1073430696 10:103484892-103484914 CATGGTGACCGTAGGACAGAAGG - Intergenic
1074640699 10:115377317-115377339 CAAGGTGTCAGCAAGACAGAAGG - Intronic
1074934870 10:118167837-118167859 ACAAGTGGCATGAGGACAGAGGG - Intergenic
1075265249 10:120995590-120995612 CCAGGTGATAGGAGTAAATAGGG + Intergenic
1075469899 10:122680187-122680209 CCAGGGGAGAGGAGGACACAGGG + Intergenic
1075475353 10:122729299-122729321 CCCAGTGCCAGGAGCACAGATGG + Intergenic
1076821005 10:132939545-132939567 CCAGGTGGGAGGAGGACACCAGG + Intronic
1076905814 10:133360408-133360430 ACAGCACACAGGAGGACAGACGG + Intergenic
1077092582 11:786450-786472 CCAGGTGCCAGAAGGGCAGGAGG + Intergenic
1078369392 11:10732480-10732502 CATGGAGACATGAGGACAGAGGG - Intergenic
1078648343 11:13163635-13163657 CCAGGTCAAAGGAGGAGAAAGGG - Intergenic
1079063458 11:17269835-17269857 CCAGGTTACAGGTGGAGAAACGG + Intronic
1079191342 11:18279476-18279498 CCTGGTCACATGAAGACAGATGG - Exonic
1079254010 11:18810784-18810806 CCAGGTGATAAATGGACAGATGG + Intergenic
1079268620 11:18960345-18960367 GCAGGAGACTGGAGGACAGCAGG + Intergenic
1080229567 11:30004026-30004048 CCAATTGACAGGAGGAAAAAAGG + Intergenic
1081850640 11:46272935-46272957 CCAGATGGCAGGCAGACAGAGGG + Intergenic
1082198968 11:49339900-49339922 GCAGGTGAAAGGAGGAAATAAGG + Intergenic
1083312270 11:61790175-61790197 TCAGGTGTCAGGAGGTCTGAGGG - Intronic
1083583738 11:63841253-63841275 CCAGGTGACAGAGGGCCAGGGGG - Intronic
1083857081 11:65398542-65398564 CCAGCTGCCAGGAGGACAAGCGG - Intronic
1084276818 11:68056317-68056339 GCAGGTGAAAGGACGGCAGAAGG - Intronic
1084284673 11:68123165-68123187 CCAGGGGACAGTGGGACAAAGGG - Intergenic
1084450139 11:69231873-69231895 CCAGGTGACAGGAGGAGGATGGG + Intergenic
1084463629 11:69309650-69309672 GCAGGTGTCTGGAGGAGAGAGGG + Intronic
1084609289 11:70191907-70191929 CATGGAGACAGGAGGGCAGAGGG - Intergenic
1085449095 11:76621369-76621391 CCAGGTGACAGGAGCTCACAGGG + Intergenic
1087208246 11:95419080-95419102 ACAGGTGGCAGAAGGAGAGAAGG - Intergenic
1088571887 11:111230613-111230635 CCTGGTGAAAGGAGGCAAGAGGG + Intergenic
1088817340 11:113430603-113430625 CCCGGAGACAGAAGGACAAAAGG - Intronic
1089170113 11:116505952-116505974 CAAAGTGAGAGGAGGAGAGAAGG - Intergenic
1089381419 11:118035538-118035560 CCAGGTGCCATCAGAACAGAAGG + Intergenic
1089405513 11:118194207-118194229 CAATGAGACAGGAGGACAGCTGG + Exonic
1090240282 11:125176765-125176787 CAAGGTGAGAGGAAGACAGCTGG + Intronic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1090715399 11:129426213-129426235 CTAGGAGAGAGGAGGACAGAGGG - Intronic
1090728566 11:129550350-129550372 CCAGGTGATAGGAGTAAATAGGG + Intergenic
1091285708 11:134407634-134407656 CCAGCTGACAGCAGGGCAGGAGG - Intronic
1092624163 12:10307746-10307768 GAAGGTGAGAGGAGGTCAGAGGG - Intergenic
1094168510 12:27466602-27466624 CCAGGAGATGGGTGGACAGAGGG + Intergenic
1094742233 12:33303172-33303194 GCAGGTGAAAGGAGGGCAGAAGG - Intergenic
1095943608 12:47741230-47741252 CCAGGAGACAGGAGCCCAAAAGG - Intronic
1096218191 12:49809862-49809884 CCAGTTGTCAGGAGGAGGGAAGG - Intronic
1096848518 12:54420743-54420765 GCAGGGGACTGGAGAACAGAAGG - Intergenic
1097636596 12:62130164-62130186 CCAAGTGACTGGAGGCCTGAGGG + Intronic
1097932138 12:65200004-65200026 CCAGGTAACAAGGGAACAGAGGG + Intronic
1099061091 12:77910283-77910305 GCAGGTCACATGAGGAAAGAGGG + Intronic
1099230213 12:80014593-80014615 CCAGGTCACAGGAGAACACCAGG - Intergenic
1099582623 12:84470599-84470621 TCATGTCACAGGAGAACAGAAGG - Intergenic
1100413328 12:94345529-94345551 GCAGGTAAAAGGAGGACAGAAGG - Intronic
1101746217 12:107543921-107543943 CCAGGTCACCTGTGGACAGAAGG - Exonic
1102216938 12:111168341-111168363 ACAGGTGACAGGCAGAGAGAAGG - Intronic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102465621 12:113129414-113129436 CCAGGAGACAGGAGGTGAGCAGG + Intronic
1103348447 12:120266107-120266129 ACAGGTGACAGACGGACAGGTGG - Intergenic
1103527565 12:121578534-121578556 CCAGGGGGCCGGCGGACAGAGGG - Intronic
1103834665 12:123809221-123809243 ACAGGAGAGAAGAGGACAGATGG - Intronic
1104140964 12:125985046-125985068 CCAGTTGACAGGAGAAAAGAAGG + Intergenic
1104919527 12:132283334-132283356 CCAGGTGACGGGAGGAATGATGG + Intronic
1105284487 13:18993280-18993302 CCAGAAGGCAAGAGGACAGAAGG + Intergenic
1105284730 13:18994747-18994769 CCAGAAGAAAGAAGGACAGAAGG + Intergenic
1105285033 13:18996495-18996517 CAGGAAGACAGGAGGACAGAAGG + Intergenic
1105947738 13:25203723-25203745 GCAGGGGTCAGGAGGATAGAGGG - Intergenic
1107430970 13:40339893-40339915 CCAGGTGTTAGGAGCACAGATGG - Intergenic
1108967449 13:56327466-56327488 TCAGTTGACAGGTGGGCAGAAGG + Intergenic
1110863304 13:80367478-80367500 GCAAGAGACAGGAGGGCAGAAGG + Intergenic
1111908568 13:94284173-94284195 CCAGGCCCCAGGCGGACAGAGGG - Intronic
1112953491 13:105031497-105031519 TCAGGTGAGAGGACCACAGAGGG + Intergenic
1113185447 13:107681765-107681787 GCTGGTGACAGGAGGAAGGAGGG - Intronic
1113585239 13:111460122-111460144 GCAGGAGAGAGGAGGAGAGAGGG + Intergenic
1114031797 14:18585489-18585511 TCAGGTGCCAGGAGGACACCAGG - Intergenic
1114533277 14:23408408-23408430 GGAGGTGACAGGAGGACAGCAGG + Intergenic
1114621813 14:24100694-24100716 CCAAGTGGCAGGAGGAGAGTTGG - Intronic
1114731755 14:25000495-25000517 CCAGAAGACAGGAGGGCAGGAGG - Intronic
1115801938 14:37004519-37004541 CCACTAGACAGGAAGACAGATGG + Intronic
1115860294 14:37678542-37678564 TCAGATGAGAGGAGGACAAAGGG - Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1117899495 14:60517121-60517143 TCACGTGGCAGAAGGACAGAAGG - Intergenic
1118387780 14:65270777-65270799 CCAGGTGACAAAAGGGAAGACGG + Intergenic
1118999242 14:70866221-70866243 CCAGGTGATAGGAGTAAATAGGG - Intergenic
1119213315 14:72849324-72849346 CCAGGAGACATGACGGCAGAGGG + Intronic
1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG + Intergenic
1121328026 14:93033177-93033199 ACAGGTGAGAGTAGGACCGAAGG + Intronic
1123042909 14:105497740-105497762 CAAGGGGACAGAGGGACAGAGGG - Intronic
1202831992 14_GL000009v2_random:44851-44873 CCAGCTACCAGGAGGAAAGAGGG - Intergenic
1202897148 14_GL000194v1_random:16764-16786 TCAGGTGCCAGGAGGACACCAGG + Intergenic
1124222258 15:27861118-27861140 TCAGGGGACAGGAGTATAGATGG + Intronic
1124451837 15:29800550-29800572 CCAGATGTCAGGAAGCCAGAGGG - Intronic
1124457803 15:29860273-29860295 CCAGGGAACAGGAGTGCAGAAGG - Intronic
1125449796 15:39796259-39796281 CTAGGTGTTAGGAGAACAGAGGG - Intergenic
1126948387 15:53851553-53851575 GCAGGTGAAAGGTGGACAGGAGG - Intergenic
1128243167 15:66115321-66115343 CCAGGGCACTGGGGGACAGATGG - Intronic
1128756906 15:70189465-70189487 CCAGGTAGCAGGTGGACAAATGG + Intergenic
1128934587 15:71734481-71734503 CCAGGGGCTGGGAGGACAGAGGG + Intronic
1129908671 15:79208095-79208117 CCAGGGCCCAGGAGGACAAATGG - Intergenic
1132629602 16:910807-910829 CAGGCCGACAGGAGGACAGAGGG + Intronic
1133218284 16:4306765-4306787 TCTGGTGGCAGGAGGAGAGAGGG - Intergenic
1133226257 16:4341877-4341899 CTAGGTGACAGGTGGGCAGCTGG - Intronic
1133537074 16:6712719-6712741 CCAGGTGATAGGAGGGGAGGTGG - Intronic
1134202098 16:12207712-12207734 TCAGGTGACAGGAGAAGAGCTGG - Intronic
1134691095 16:16191490-16191512 CCAGGTGACAGACGGACACTGGG + Intronic
1134748378 16:16605615-16605637 CTAGGTGACAGAGGGACACAGGG - Intergenic
1134997086 16:18748004-18748026 CTAGGTGACAGAGGGACACAGGG + Intergenic
1135051426 16:19196070-19196092 CCAGGTGCCAGAAGGTCACAGGG + Intronic
1135069603 16:19340430-19340452 TCAGGTAAAAGGAGGACAGGAGG - Intergenic
1135071632 16:19357226-19357248 CCAGGTGAAAGGATGACTGAAGG - Intergenic
1136555420 16:31004918-31004940 CCATCTGTCAGCAGGACAGAAGG - Intronic
1136606123 16:31335112-31335134 ACATGTGGCAGGAGGAGAGAGGG + Intergenic
1136685160 16:31989705-31989727 CTAGGTGATAGGAGCACAGTGGG + Intergenic
1136707311 16:32201077-32201099 CAAAGCGACAGCAGGACAGACGG - Intergenic
1136760601 16:32728340-32728362 CAAAGCGACAGCAGGACAGACGG + Intergenic
1136785771 16:32933240-32933262 CTAGGTGATAGGAGCACAGTGGG + Intergenic
1136807502 16:33142046-33142068 CAAAGCGACAGCAGGACAGACGG - Intergenic
1136883998 16:33920564-33920586 CTAGGTGATAGGAGCACAGTGGG - Intergenic
1137564861 16:49526596-49526618 CCGGGCTGCAGGAGGACAGAGGG + Intronic
1137693655 16:50447027-50447049 CCAGTTGGCAGGTGGGCAGAGGG - Intergenic
1138376288 16:56566260-56566282 CCAAGTGCCAGGATTACAGATGG - Intronic
1138512122 16:57514971-57514993 CCAGGTGACACCAAGACAGCAGG - Intronic
1139397794 16:66654361-66654383 CCATGTGACAGGAGGCAGGATGG - Intronic
1139940464 16:70601751-70601773 CCAGGTGGGATGGGGACAGAGGG + Intronic
1140219178 16:73031431-73031453 CCAGGTATCAGGAGGCCAAAGGG + Intronic
1140559927 16:75967108-75967130 AGAGGTGAGAGGAGGACAGACGG + Intergenic
1141554660 16:84829108-84829130 TGAGGTGACAGGAGGAGAGAAGG + Intronic
1141735523 16:85849850-85849872 CCAGATGAGAGGAGAAGAGAGGG - Intergenic
1141956916 16:87378546-87378568 CCTGGTGACAGGGGTACAAAGGG + Intronic
1142175212 16:88642139-88642161 CCAGGTGAGAGGGGGACCGCAGG + Intergenic
1142229061 16:88891084-88891106 TCAGGTGAAAGCAGGTCAGATGG - Intronic
1142264465 16:89057440-89057462 CCACTTGGGAGGAGGACAGAAGG - Intergenic
1203062754 16_KI270728v1_random:988655-988677 CAAAGCGACAGCAGGACAGACGG + Intergenic
1203088005 16_KI270728v1_random:1194902-1194924 CTAGGTGATAGGAGCACAGTGGG + Intergenic
1142515251 17:423599-423621 CTAGGTGACATGAGGACAGAAGG - Intronic
1142682929 17:1561263-1561285 CCAGGGGACTGGGGGACAGGTGG - Intronic
1143104366 17:4521217-4521239 CTAGGTGGCAAGTGGACAGAAGG - Intronic
1143383019 17:6508121-6508143 CCAGGTGCCAAGAGGCCAGGAGG + Intronic
1143517381 17:7426685-7426707 TCAGGTGACAGGTAGAGAGAGGG - Exonic
1144325155 17:14172104-14172126 CCAGTTGAGTGGAAGACAGATGG - Intronic
1144439271 17:15266822-15266844 CCATGTCAGAGGAGGACTGAGGG - Intergenic
1144474031 17:15568983-15569005 CCAGTTGAGTGGAAGACAGATGG - Intronic
1144580695 17:16457449-16457471 CCAGAGGGCAGGAGGAGAGACGG + Intronic
1144629700 17:16864732-16864754 CCAGGAGAGGGGAGGACGGAAGG + Intergenic
1144651728 17:17011385-17011407 CCAGGAGAGGGGAGGACGGAAGG - Intergenic
1144827725 17:18115772-18115794 CCAGGTGGCTGGAGGGCAGTGGG - Intronic
1145191075 17:20842510-20842532 CAAAGTGGCAGCAGGACAGATGG - Intronic
1145748255 17:27336512-27336534 ACAGGTGACAGGAGGGGAGGGGG - Intergenic
1145769006 17:27479114-27479136 CAGGGAGACAGGAGCACAGAGGG - Intronic
1146508286 17:33424224-33424246 CTAGGTGGCAGGAGGAGAAATGG - Intronic
1146687490 17:34851059-34851081 CCAGGTGATAGGGGGAGAGGTGG + Intergenic
1146788303 17:35736491-35736513 CCTGGGGTCAGGAGGAAAGATGG + Intronic
1147146102 17:38485386-38485408 CTAGGTGATAGGAGCACAGTGGG + Intronic
1147172494 17:38630492-38630514 CGAGGTGCCAGGATGGCAGACGG + Intergenic
1147186804 17:38717499-38717521 CCAGGAGGCTGGAGGAGAGAGGG - Exonic
1147366750 17:39964142-39964164 CCAGCTGCCTGGAGGACTGAGGG + Intronic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1148229118 17:45920229-45920251 CCAGGTGACAGGAGGACAGAGGG - Intronic
1148698059 17:49573007-49573029 CCAGGGGCTAGGAGGACAGGTGG - Intergenic
1149380505 17:56088661-56088683 CCAGGAGAAAGGAGAACAGGAGG - Intergenic
1150220915 17:63495444-63495466 CCAGGTGCCAGGAGGCAAGGTGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150456107 17:65308163-65308185 CCAGGTGACTGGGGGTCAGTAGG + Intergenic
1151384110 17:73744677-73744699 GCTGGTGACAGCAGGACAGCAGG - Intergenic
1151606853 17:75143018-75143040 GCAGGTAAAAGGAGGACAGGAGG - Intronic
1151994499 17:77600229-77600251 TCAGAAGACAGGAGGAAAGATGG - Intergenic
1152233877 17:79128441-79128463 ACAGGTGGCAGGGGGACAGGAGG + Intronic
1152285041 17:79407628-79407650 CGAGTTGTCTGGAGGACAGAGGG + Intronic
1152413304 17:80142383-80142405 GCAGGTGAAAGGAGAGCAGAAGG - Intronic
1152428845 17:80236301-80236323 CAAGGTCACAGGAGCAGAGAGGG - Intronic
1152789195 17:82269579-82269601 CCAGGTAACAGGTGGACAAATGG + Intronic
1152790040 17:82273810-82273832 CGGGGTAACAGGAGGGCAGAGGG - Intergenic
1152857355 17:82673374-82673396 CCAGATGGGAGCAGGACAGAAGG - Intronic
1153455950 18:5282391-5282413 ACAGGTGAAAGAAGGACAGAAGG - Intergenic
1153973077 18:10244093-10244115 CCAGGAGACAGGAGAAGACAAGG + Intergenic
1156391280 18:36652736-36652758 GGGGGTGACAGGAGGGCAGATGG - Exonic
1156869917 18:41933738-41933760 CCAGGAGAGGGGAGGACAGGGGG + Intergenic
1157181836 18:45505278-45505300 GCAGGGGGTAGGAGGACAGAGGG - Intronic
1157803948 18:50644282-50644304 GCAGCTGACAGGAAGACTGAGGG + Intronic
1158386558 18:56999753-56999775 CAAGGAGACAGGAGGAAGGATGG + Intronic
1158456430 18:57612233-57612255 CCAGGGGAAAGCAGGACAGAAGG + Intronic
1158673867 18:59500987-59501009 CCAGTTTACAGGTGGACAAAGGG + Intronic
1159352827 18:67298175-67298197 CCAGATGACTGGAGGCCACATGG + Intergenic
1159576246 18:70181186-70181208 CCAGTTCACAGCAGGTCAGATGG + Intronic
1160293385 18:77616201-77616223 CCAGGTGCCAGGAGCCTAGAGGG + Intergenic
1160995127 19:1878913-1878935 CAAAGTGGCAGCAGGACAGATGG + Intronic
1161147681 19:2688802-2688824 CAAAGTGTTAGGAGGACAGACGG - Intronic
1161378952 19:3954438-3954460 CCAGAGGTCAGGAGGCCAGAAGG + Intergenic
1163130526 19:15269946-15269968 CCAGGTGTGAGGATCACAGAGGG + Intronic
1163826675 19:19528128-19528150 CCAGGTGGCCGGAGGGCACAGGG - Exonic
1164684674 19:30158941-30158963 GGAGGGGAGAGGAGGACAGAAGG - Intergenic
1164830669 19:31317621-31317643 CCAGGTGTGAGGAGAACAGCAGG + Intronic
1165158676 19:33803240-33803262 TCAGGGGACAGGAGGCCAGGGGG + Intronic
1165162235 19:33823582-33823604 TCAGGAGACTGGAGGGCAGAAGG + Intergenic
1165823607 19:38692976-38692998 CCAGGTACCCGGAGGCCAGACGG - Intronic
1166128632 19:40731862-40731884 GCAGGTGAAAGGAGGGCAGGAGG + Intronic
1166158049 19:40930131-40930153 CCAGGAGAGTGGAGGAGAGAGGG + Intergenic
1166166916 19:40997160-40997182 CCAGGAGAGTGGAGGAGAGAGGG + Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1168260018 19:55188059-55188081 CCAGGTGGGGAGAGGACAGAGGG - Exonic
1168413828 19:56156612-56156634 GCAGGTGAAAGTAGGGCAGAAGG + Intronic
1168701754 19:58444115-58444137 CCTGGTGCCAGGACAACAGAGGG - Intergenic
1202640690 1_KI270706v1_random:82901-82923 CCAGCTACCAGGAGGAAAGAGGG + Intergenic
927489816 2:23513688-23513710 TCAGAGGACAGGAGGGCAGAGGG + Intronic
927673898 2:25090763-25090785 CCAGGAGATAGGACGATAGAGGG + Intronic
928027406 2:27751571-27751593 GCAGGTGACAGGAGGATGGGTGG - Intergenic
928202332 2:29256168-29256190 CCAGGGGACAGGAGGAGTCAAGG + Intronic
928398037 2:30958087-30958109 CCAGGTGACAGGATGTCCCACGG + Intronic
928619338 2:33072607-33072629 GCAGGTGAAAGGAAGGCAGAAGG + Intronic
931783837 2:65601576-65601598 CGAGGTGCCAGGATGGCAGACGG - Intergenic
931797873 2:65729076-65729098 CTGAGTGACAGGAGGAGAGAAGG + Intergenic
932731775 2:74226850-74226872 ACAGCTGACAGGAAGGCAGAAGG + Intronic
933027863 2:77284702-77284724 TGAGGTGAAAGGAGCACAGAAGG - Intronic
933147496 2:78872540-78872562 CCAGCTGACAAGTGGACTGATGG - Intergenic
934148957 2:89127020-89127042 CAAAGTGACAGGAGGACACAAGG - Intergenic
934218337 2:90055026-90055048 CAAAGTGACAGGAGGACACAAGG + Intergenic
934560683 2:95311758-95311780 CAAGGTGACAGCATCACAGATGG - Intronic
934897177 2:98128984-98129006 CCAGTTCCCAGGAGGAGAGAGGG - Intronic
934964116 2:98704982-98705004 GCAGGTGACAGGAGGACATCTGG + Intronic
935689666 2:105719439-105719461 CCATGAGACAGGGTGACAGAGGG + Intergenic
936272205 2:111057552-111057574 CCAGGGGCCAGGAGTAGAGAGGG + Intronic
936430371 2:112457539-112457561 ACAGATGACAGAAGGACAAATGG + Intergenic
936548256 2:113411698-113411720 CCAGGGGACTGGAGAAAAGAAGG + Intergenic
936668454 2:114627231-114627253 CCAGCTGCCAAGAGAACAGATGG + Intronic
937057407 2:118951202-118951224 CTTGGTGACAGGATGATAGATGG - Intronic
937307528 2:120881521-120881543 GCAGGTGGGAGGAGGACAGTGGG + Intronic
937452242 2:122011175-122011197 TCAGGGGACAGGAGCAGAGAGGG + Intergenic
937971272 2:127551211-127551233 AGAGATGACAAGAGGACAGATGG - Intronic
938245741 2:129776495-129776517 GCAGGAGACTGGAGGCCAGATGG - Intergenic
938319496 2:130353681-130353703 TCAGGTGTCAGGAGGACAGGTGG + Intergenic
938491163 2:131762034-131762056 TCAGGTGCCAGGAGGACACCAGG - Intronic
938496401 2:131800303-131800325 CCAGGTGCCAGGAGGACACCAGG + Intronic
938928304 2:136064253-136064275 GTAGGAGACAGGAGGTCAGAAGG - Intergenic
940736519 2:157459444-157459466 CCATTTTACAGGAGGACTGAGGG + Intronic
941595509 2:167471909-167471931 CCAGGTGGTAGGAGAGCAGAGGG + Intergenic
942097327 2:172546518-172546540 CCAGGTGACAGGAGTAAATAGGG + Intergenic
942284001 2:174395778-174395800 CGAAGTGACAGGTGGACGGAGGG - Exonic
942370197 2:175275765-175275787 CCAGGTTACAGGAAGAAAGGGGG - Intergenic
944764060 2:202846568-202846590 GCAGGTCAAAGGAGGGCAGAAGG + Intronic
944882273 2:204025907-204025929 CCTGGGCACAGGAGGACGGAGGG - Intergenic
945673788 2:212832274-212832296 TCAGCTGACTGGAGGACAGCAGG - Intergenic
945947326 2:216006854-216006876 CCAGGTGCCAGTGGGAAAGAAGG - Intronic
946032849 2:216718563-216718585 ACAGGTCACAGGAGAGCAGAGGG + Intergenic
946311386 2:218884130-218884152 AAAGGGAACAGGAGGACAGAGGG - Intronic
947331583 2:229034628-229034650 CCAGGGTACAGGAAGACTGATGG - Intronic
947626433 2:231621994-231622016 GCAGGTTTAAGGAGGACAGAGGG - Intergenic
948018491 2:234710060-234710082 CGAGGTGGCAGGAGCACAGAAGG - Intergenic
948063003 2:235055765-235055787 CTAGATGACAGTAGGACAGCTGG + Intergenic
948631118 2:239303209-239303231 CCTGGGGACAGGAGGGCACAGGG + Intronic
948667511 2:239545779-239545801 CCAGGTGACAGGAGGGAAGGCGG - Intergenic
1169030673 20:2404501-2404523 TCAGGGGACAGGAGGAGACAGGG - Intronic
1170537567 20:17356587-17356609 CCAGATGAGAGAAGGACAGCAGG - Intronic
1171480296 20:25450179-25450201 GCAGGTGAAAGGAGGGCAGAAGG + Intronic
1171887577 20:30669648-30669670 CCAGCTACCAGGAGGAAAGAGGG + Intergenic
1172270851 20:33655004-33655026 GCAGGTGACAGGGAGACAGGAGG - Intergenic
1172663017 20:36580277-36580299 TCAGGTGACAGGAGTTCTGAGGG - Intronic
1172871234 20:38136700-38136722 GCAGGTGTGAGGAGGGCAGAGGG - Intronic
1173467052 20:43291482-43291504 CCAGGTAACAGGAGATAAGATGG + Intergenic
1173501896 20:43559859-43559881 CCATGTAACAGTGGGACAGAGGG + Intronic
1174001850 20:47380496-47380518 CCACGTAACAGGAGCAGAGAAGG + Intergenic
1174093717 20:48070473-48070495 CCAGCTGGCAGACGGACAGAGGG - Intergenic
1174571930 20:51508305-51508327 CGAGGTGAGAGGTGGAGAGAGGG - Intronic
1174914366 20:54639303-54639325 CCAGGTGACAGAGGTAGAGAAGG - Intronic
1175319792 20:58077390-58077412 CAGGGCGACAGCAGGACAGAAGG - Intergenic
1175380236 20:58557735-58557757 TCAAGTGATAGCAGGACAGAGGG + Intergenic
1175463643 20:59174110-59174132 CCTGGGCACAGCAGGACAGAAGG + Intergenic
1175700629 20:61134385-61134407 CCTTGTGACAGGAGGTGAGATGG - Intergenic
1175793709 20:61758148-61758170 CCCCGGGACAGGTGGACAGAGGG + Intronic
1175920174 20:62446922-62446944 CCAGGGGACAGGAGGAGGGGAGG - Intergenic
1176078999 20:63262361-63262383 CGAGGTGACGGGAGGACGGTGGG - Intronic
1176079011 20:63262401-63262423 CGAGGTGACGGGAGGACGGTGGG - Intronic
1176267441 20:64217630-64217652 ACAGGTAGCAGGAGGACAGTGGG - Intronic
1176616833 21:9032753-9032775 TCAGGTGCCAGGAGGACACCAGG + Intergenic
1176938065 21:14889543-14889565 CCTGGTGGCAGGAGGAGTGATGG - Intergenic
1177217924 21:18153300-18153322 CCATGTGACTGTAGGACTGAGGG + Intronic
1178466669 21:32854471-32854493 CCAGGTGATAGGAGTAAATAGGG - Intergenic
1178842820 21:36151575-36151597 CCAGGTGAAGGCAGGACAGCTGG - Intergenic
1178985373 21:37298644-37298666 CCAGGGGACAGCAGAACAGGGGG - Intergenic
1179183067 21:39061830-39061852 CCATGTGAGAGGCGGGCAGAGGG - Intergenic
1179482306 21:41685950-41685972 CCTGTTGACAGGAGGATAGTGGG - Intergenic
1179541957 21:42088760-42088782 CGAGGGGGCAGGAGGCCAGAGGG - Intronic
1179657753 21:42855720-42855742 CCAGGTGACAGCAGTGCAGCTGG + Exonic
1179786727 21:43734525-43734547 CCAGGAGGCAGGTGGACAGCAGG - Intronic
1179880759 21:44292478-44292500 CCAGGGGACAGACGGACAGGAGG - Intronic
1180180403 21:46116355-46116377 CCTGGGGGCAGGAGGAGAGAGGG - Exonic
1180361252 22:11898961-11898983 CCAGCTACCAGGAGGAAAGAGGG - Intergenic
1180455911 22:15512546-15512568 TCAGGTGCCAGGAGGACACCAGG - Intergenic
1180703060 22:17792110-17792132 CACTGTGGCAGGAGGACAGAAGG + Intronic
1181007140 22:20019158-20019180 CTAGGTGAGAGGATGAGAGAGGG - Intronic
1181121191 22:20669451-20669473 CAAAGTGGCAGCAGGACAGATGG + Intergenic
1181334151 22:22116477-22116499 CAAAGTGGCAGCAGGACAGATGG + Intergenic
1182043466 22:27256482-27256504 CCATGTTACAGGTGGAGAGATGG - Intergenic
1182892174 22:33828165-33828187 AAAGGTGCCAGTAGGACAGATGG + Intronic
1183120965 22:35729733-35729755 ACAGATGACAGGAGGGAAGAGGG - Intergenic
1183648811 22:39142001-39142023 TCGGGTGCCAGGAGGAGAGAGGG + Intronic
1183834123 22:40437991-40438013 ACTAGTGACAGGAGGACAGGAGG + Intronic
1184088799 22:42281863-42281885 GCAGGTGCCAGGAGTGCAGAGGG + Intronic
1184091468 22:42295111-42295133 GCAGGGCACAGGAGGAGAGAGGG + Intronic
1184154398 22:42657742-42657764 CCAGGGAACAGGGGGGCAGAGGG - Intergenic
1184239173 22:43202904-43202926 CCAGGTGTCAGCAGGAAACAAGG - Exonic
1184366373 22:44054166-44054188 GCAGGTGAAAGGAGGGCAGAAGG + Intronic
1184787740 22:46680037-46680059 CCAGAAGACAGGAGGCCAGGTGG + Intergenic
1184870528 22:47235075-47235097 CTAGGTGATGGGTGGACAGATGG - Intergenic
1184900836 22:47445507-47445529 CAGGCAGACAGGAGGACAGACGG - Intergenic
1184900849 22:47445571-47445593 CAAGTAGACAGGAGGACAGGCGG - Intergenic
1184900860 22:47445635-47445657 CAAGCAGACAGGAGGACAGGAGG - Intergenic
1185185648 22:49398125-49398147 CCGGGTGCCAGGAGTACGGAGGG + Intergenic
950215550 3:11155716-11155738 ACCTGTGACAGGAGCACAGACGG + Intronic
952748052 3:36800663-36800685 TCAGGAGACAGGAGGAGAAAAGG + Intergenic
952961977 3:38598075-38598097 CTAGGTGACAGCGGGACAGTGGG + Intronic
953787854 3:45924110-45924132 ACAGGAGACAGCTGGACAGATGG - Intronic
953797718 3:45997996-45998018 GCAGGTGAAAGGAGGGCAGAAGG + Intergenic
953848404 3:46446940-46446962 GCGGGGGACAGGAGGACATAAGG + Intronic
954116710 3:48470567-48470589 CCTGGAGGCAGGAGGCCAGAGGG + Intronic
954884009 3:53856123-53856145 GCAGGTGTGAGGAGGTCAGAGGG + Intronic
954934983 3:54318208-54318230 CCAGGAGAGAAGAGCACAGACGG + Intronic
955559509 3:60173554-60173576 CCAGGACACAGGATGACAAATGG + Intronic
956725647 3:72154613-72154635 CCAGGTGGGAGGAAGACAGAAGG + Intergenic
956920533 3:73923935-73923957 TTAGGTGACAGGAGGCGAGAAGG + Intergenic
959412082 3:106036848-106036870 CCAGGTTGCAGGAAGAGAGATGG - Intergenic
960829417 3:121830728-121830750 GCAGGTGAAAGGAGGAGAGGAGG - Intronic
961495078 3:127285372-127285394 CCAGGTGACAGGGGGGCCGGGGG + Intergenic
962044306 3:131739396-131739418 TCAGGAGGCAGAAGGACAGAGGG - Intronic
962070424 3:132028201-132028223 CAAGGAAACAGGTGGACAGAAGG - Intronic
962677634 3:137768510-137768532 CCAGGTCTAAGGAGGGCAGATGG - Intergenic
963326784 3:143871820-143871842 GCAGGTGAGAGGAAGACAGTTGG + Intergenic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
967149933 3:186639194-186639216 ACAGGTGAAAGGAAGAGAGAAGG + Intronic
967746829 3:193065688-193065710 AAAAGTGACAGGAGGAAAGAAGG + Intergenic
967938776 3:194750074-194750096 CCTGGGGACAGACGGACAGATGG - Intergenic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
968649023 4:1753135-1753157 CAAGGGGACAGCAGGAGAGAAGG - Intergenic
968666739 4:1826541-1826563 CCAGGTGACAGCAGCAGACATGG - Intronic
968969602 4:3786724-3786746 CCAGGTGGGAGGAGGCCAGCTGG - Intergenic
969367934 4:6710333-6710355 CCAGGGGTGGGGAGGACAGAAGG - Intergenic
969499113 4:7542440-7542462 GCAGGTGACACGAAGACATATGG + Intronic
969624009 4:8293396-8293418 CCAGGGACCAGGAGGACAAAGGG + Intronic
969967759 4:11014499-11014521 CCAGTTGACAGGAGGCATGAGGG + Intergenic
972380643 4:38516754-38516776 CCAGACGAAAGGAGGACTGATGG + Intergenic
973384207 4:49493433-49493455 CCAGCTACCAGGAGGAAAGAGGG + Intergenic
973958632 4:56087970-56087992 CATGGTGACAGAAGGAGAGATGG - Intergenic
974102661 4:57435073-57435095 CCAGGTTCCAGGAGAGCAGATGG + Intergenic
974377339 4:61095417-61095439 CCAGGTCACATGAGGCCGGAAGG + Intergenic
974715773 4:65668596-65668618 CCAAGAGGCAGGCGGACAGAGGG + Intronic
974837288 4:67266235-67266257 TCAGGTGGCAGAAGGGCAGAAGG + Intergenic
975736441 4:77385810-77385832 ACAGGAGACAGAAGAACAGAAGG - Intronic
975766806 4:77677093-77677115 CCAGAAGACTGGAGGACAGGAGG + Intergenic
976954900 4:90883699-90883721 CACGGTGACAGAATGACAGAAGG - Intronic
977332807 4:95658988-95659010 TCAGCTGACAGGAGGGCATAGGG - Intergenic
977709986 4:100113901-100113923 GCAGGAGACAGGAGGGCAGGAGG - Intergenic
980684412 4:136207624-136207646 ACAGGGGAAAGAAGGACAGAAGG + Intergenic
980854172 4:138419400-138419422 CCAGGAGGCTGGAGGTCAGAAGG - Intergenic
980893922 4:138843110-138843132 CCAAAGGACAGGAGGACAGAAGG + Intergenic
981913522 4:150009306-150009328 TTAGGAGAGAGGAGGACAGATGG + Intergenic
982486059 4:155967271-155967293 TCAGTTGGCAGGAGGACAAAGGG + Intergenic
982537270 4:156622225-156622247 CAAGGTGACAGCAGTGCAGATGG + Intergenic
982606612 4:157523963-157523985 CCAGGTGACTGGAATAAAGAGGG - Intergenic
983882326 4:172947299-172947321 CAAGATGCCAGGAGGAGAGAGGG + Intronic
984402698 4:179287306-179287328 CAAGGTGAGAGCAGGTCAGAGGG + Intergenic
984830946 4:183972249-183972271 TCAAGTGGCAGAAGGACAGAGGG - Intronic
984850059 4:184144962-184144984 TCAGGTCAGCGGAGGACAGAGGG + Intronic
985244952 4:187971111-187971133 CCAGCTGACAGCAGAAAAGAGGG + Intergenic
986002758 5:3643119-3643141 CCCCATAACAGGAGGACAGAGGG - Intergenic
986365029 5:7021169-7021191 TCTGTAGACAGGAGGACAGATGG - Intergenic
987210589 5:15678033-15678055 GCAGGAGACAGAAGGACATATGG - Intronic
989753721 5:44925677-44925699 GCAGATGATAGGAGTACAGAGGG - Intergenic
990178515 5:53134295-53134317 CCAGGTGTTAGAATGACAGATGG + Intergenic
993109057 5:83632973-83632995 ACAGGAGACAGGAGGGCAGGAGG - Intergenic
994232779 5:97327980-97328002 CAATGTGACAGTAGGCCAGACGG + Intergenic
995190286 5:109312272-109312294 CCAGTTGAAAGGGGGAAAGAGGG + Intergenic
996287816 5:121815538-121815560 CCAGCAGACAGTAGGGCAGAGGG - Intergenic
997257968 5:132443777-132443799 CCAGTAGGCAGGATGACAGATGG - Intronic
997634138 5:135392101-135392123 CAAGTTGACAAGAGGACAAAGGG - Intronic
998273164 5:140725629-140725651 CTGGGTGACAGGGTGACAGAGGG + Intergenic
999191367 5:149749940-149749962 CCTGGAGACAGATGGACAGATGG + Intronic
999433032 5:151540332-151540354 GCAGGAGAAAGGAGGACCGAGGG - Intronic
1002110949 5:176912088-176912110 TCAGGTGTTAGGAGGAAAGAAGG - Intronic
1002421109 5:179149519-179149541 CCAGGAGCCAGGAGGATGGAAGG + Intronic
1003381290 6:5626507-5626529 CCAGGTGACAAGTTGACAGTGGG - Intronic
1005892654 6:30153053-30153075 CCTGGGGGCAGGAGGACATAAGG - Exonic
1006193704 6:32224219-32224241 GCAGGTGATAGGAGGGGAGAAGG + Intergenic
1006395570 6:33784986-33785008 AAAGGAAACAGGAGGACAGACGG + Intronic
1006561630 6:34917912-34917934 CCAGGTGAAAGGAGGGCAGCTGG - Intronic
1007092794 6:39194526-39194548 ACAGGTGAGGGGAGGACAGGAGG - Intronic
1007673866 6:43579169-43579191 GCAGGTGAAAGGAGGGCAGAAGG - Intronic
1007737850 6:43993012-43993034 CCAGGTGACAGCAGGCCTGCCGG + Intergenic
1007750563 6:44068340-44068362 CCAGCTGGCAGAAGGACAGGTGG + Intergenic
1007930600 6:45687265-45687287 CCAGGGGTCAGGAGCAAAGATGG - Intergenic
1009435796 6:63616982-63617004 ACAGGTGACAGAAGGGCAAAGGG + Intergenic
1010303145 6:74284991-74285013 GGAGGTGACAGGAGGAGAGGAGG - Intergenic
1010608545 6:77922953-77922975 ACCAGTGACAGGATGACAGAAGG + Intronic
1010689404 6:78891024-78891046 TCAGGGGACAGGAGGACTAAGGG + Intronic
1010771221 6:79833361-79833383 GCAGATGACAGGAGCAGAGACGG - Intergenic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1011241525 6:85276609-85276631 GCAGGTGATAAGAGGAAAGAAGG - Intergenic
1011715323 6:90098990-90099012 GAAAGTGACAGGAAGACAGAAGG - Intronic
1013180446 6:107712802-107712824 GAAGGTGTCAGGAAGACAGATGG + Intronic
1013546407 6:111161872-111161894 CCAGGTGATAGGAGTAAACAGGG - Intronic
1013680553 6:112521103-112521125 CCAGTTGACAGAAGTACAGATGG - Intergenic
1014166790 6:118233930-118233952 CCAGTTGACAATAGGAGAGAAGG - Intronic
1015613027 6:135046072-135046094 GCAAGTGGCAGGAGGAAAGAGGG - Intronic
1015757881 6:136626447-136626469 CCAGGTGATAGGTGATCAGAGGG + Intronic
1017010601 6:150060800-150060822 TCAGGAGAGAGGAGGACACAGGG - Intergenic
1017140480 6:151185152-151185174 CCAGATGACAGATGGACAGTAGG - Intergenic
1017559395 6:155610524-155610546 CTAGGTGACAGGAGTAAATAGGG - Intergenic
1017592623 6:155993512-155993534 CCGGGTGACATGCAGACAGAGGG + Intergenic
1017942698 6:159067130-159067152 CCAGTAGACAGCAGGACAAAAGG + Intergenic
1017999839 6:159569341-159569363 CCAGTTGGCATGAGCACAGAGGG - Intergenic
1018847783 6:167567174-167567196 ACAGGGGACAGGAGGGAAGATGG + Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019183835 6:170209475-170209497 ACAGGCTACAGGAGGACAGCTGG + Intergenic
1019315131 7:380661-380683 GGAGGGGGCAGGAGGACAGAGGG + Intergenic
1019564247 7:1671706-1671728 CCAGGGGGCAGGAGGCCAGGGGG - Intergenic
1019847852 7:3524432-3524454 TCAGGTGATAGCAGTACAGATGG + Intronic
1022018685 7:26377169-26377191 CCAGGCCGCCGGAGGACAGAAGG + Intergenic
1022183003 7:27940096-27940118 GCAGGTGAGAGGAGGGCAGCAGG - Intronic
1023014605 7:35954917-35954939 CCTGGCGACAGAGGGACAGAGGG + Intergenic
1023031403 7:36093203-36093225 TCAGGTAACAGCAGGCCAGACGG + Intergenic
1023097801 7:36680481-36680503 CCAGGTGAATGGGGGACAGAAGG - Intronic
1023368668 7:39490428-39490450 CCAGGTGGCTGCAGGCCAGAAGG + Intronic
1023563085 7:41496082-41496104 CAAGGGGGCAGGATGACAGAGGG - Intergenic
1023823144 7:43991207-43991229 CCAGGCTACAGGGGGACAGCAGG - Intergenic
1023861344 7:44219180-44219202 CCAGAGGCCAGGAGCACAGACGG + Exonic
1023874839 7:44281339-44281361 CCTGGGGCCAGGAGGACAGCAGG + Intronic
1024058353 7:45680750-45680772 TCAAGTGAAAGCAGGACAGAAGG + Intronic
1024608192 7:51039912-51039934 CAGGGTGACAGTTGGACAGAGGG + Intronic
1025821756 7:64968804-64968826 CAAGGTGCCAGGATGGCAGACGG - Intergenic
1026500258 7:70937702-70937724 CCATGTACCAGGAGGACACAGGG + Intergenic
1028283504 7:88964510-88964532 CCAGGAGTCAGGAGGAAAGATGG + Intronic
1028556803 7:92134193-92134215 CCAGGTGGCCGGCGGCCAGACGG + Exonic
1029180666 7:98699255-98699277 CCCAGCGACAGGAGGACAGGAGG - Intergenic
1029751408 7:102544645-102544667 CCAGGCTACAGGGGGACAGCAGG - Intronic
1029769360 7:102643738-102643760 CCAGGCTACAGGGGGACAGCAGG - Intronic
1030555207 7:111015395-111015417 GCAAGAGACAGGAGGAAAGAGGG + Intronic
1031342526 7:120621308-120621330 CCAGGTGACAGGATACCATATGG - Intronic
1031879946 7:127186426-127186448 CCAAGTGGCAGGAGAGCAGAAGG + Intronic
1034060616 7:148084225-148084247 CCAGGTGGCAGCAGGAAACAAGG - Intronic
1034156370 7:148959149-148959171 GCAGGCGAAAGGAGGGCAGAAGG - Intergenic
1035126104 7:156608400-156608422 CCATTTGACAGGAAGTCAGAGGG - Intergenic
1035132675 7:156669876-156669898 CCAGGTGACAGGAGGGCGGGCGG + Intronic
1036462179 8:8963281-8963303 CCAAGAGCCAGGACGACAGAGGG - Intergenic
1036638182 8:10565503-10565525 CCAGAAGACAGGAGGTGAGAGGG - Intergenic
1036656875 8:10682518-10682540 CCAGGGAACAGGTGCACAGAGGG - Intronic
1036746322 8:11412667-11412689 GCAGGGGACAGAAGGACAGCGGG - Intronic
1037243791 8:16807473-16807495 CCAGGTGACAGGCGGGGAGTAGG - Intergenic
1037684772 8:21129484-21129506 CCAGTGGACAGAAGGACAGTGGG + Intergenic
1038532720 8:28331553-28331575 CCAGGTGAGAGGAGTTCAGGAGG - Intronic
1039023870 8:33236420-33236442 ACAGGTGACAGGGAGATAGAAGG + Intergenic
1039381875 8:37092991-37093013 CCAGGTGACATGCAGACATAAGG + Intergenic
1039387296 8:37147392-37147414 TCAGGTGGCAGGAGGACAGCTGG + Intergenic
1039773921 8:40716923-40716945 CCAGGGAACAGGAGGAGAAAAGG - Intronic
1040809967 8:51440924-51440946 CCAGGTGACTGTGGGAGAGAGGG + Intronic
1041693739 8:60714552-60714574 CCAGGGGCCAGGAGGGCTGAGGG - Intronic
1041737640 8:61128568-61128590 CCAGGGGAGAGCAGGACACAGGG + Intronic
1041778046 8:61545947-61545969 CCAGCTTCCAGGAGGAGAGAGGG - Intronic
1042396744 8:68300252-68300274 GCAGGGGAGAGGAGGACAGGGGG + Intergenic
1042451090 8:68947015-68947037 CCAGGAAACAGAATGACAGAGGG - Intergenic
1043573385 8:81630226-81630248 GCAGATGAAAGGAGGACAGAAGG + Intergenic
1045023476 8:98064376-98064398 CCAGGAGACAGGAGGGGAGACGG - Exonic
1045571049 8:103370166-103370188 ACAGGCCAAAGGAGGACAGAGGG + Intergenic
1047241738 8:123096225-123096247 CCAGGTGACAGAAGGCCTCAGGG - Intronic
1047581352 8:126219220-126219242 CCAGGTGATAGGAGTAAATAGGG - Intergenic
1047927339 8:129694518-129694540 CCAGAAGGCAGGAGGACAGCTGG - Intergenic
1048498118 8:134952203-134952225 CCAGGGGACAGGATGGCAGAAGG - Intergenic
1048844687 8:138595219-138595241 CAAGGTGGCAGGAGGACAGGTGG + Intronic
1048899315 8:139022476-139022498 CCAGGTGCCTGGGGGTCAGAAGG + Intergenic
1048931733 8:139320734-139320756 CCGGCTGACAGGAGGATGGAGGG + Intergenic
1049041863 8:140118572-140118594 CCAGGTGGCAGGAGCAGAGAAGG + Intronic
1049267861 8:141678933-141678955 GGAGGTGACAAGGGGACAGATGG - Intergenic
1049563809 8:143326975-143326997 GGAGGGGACAGAAGGACAGAAGG + Intronic
1050412916 9:5385015-5385037 CAAGGTGAGATGAGGTCAGATGG + Intronic
1053727306 9:41017089-41017111 CCAGGGGACTGGAGAAAAGAAGG - Intergenic
1056452784 9:86732969-86732991 CGAGAAGACAGGAGGACATATGG + Intergenic
1056708243 9:88969640-88969662 ACAGGTGACAGGAGAAGGGAGGG + Intergenic
1058244307 9:102604005-102604027 CGAGGTGCCAGGAGTGCAGACGG - Intergenic
1058348991 9:103999397-103999419 TCAGGTGTCTGCAGGACAGAGGG - Intergenic
1058661234 9:107271232-107271254 CGAGGTGCCAGGATGGCAGACGG + Intergenic
1058735368 9:107889191-107889213 CCAGCTGGCATGAGGACAGTAGG - Intergenic
1058915980 9:109566117-109566139 CCAGGTTCTAGGAGGAGAGAGGG + Intergenic
1059346780 9:113634425-113634447 TCAGGGGACAGGGGGACCGAGGG + Intergenic
1059429885 9:114243580-114243602 CCTGGGGACAAGAGGAAAGAGGG + Intronic
1059771025 9:117425793-117425815 CAAGGTGACAGGAGCAAAGCAGG + Intergenic
1060218049 9:121750262-121750284 CGAGCGGGCAGGAGGACAGAGGG - Intronic
1060496688 9:124124697-124124719 CCAGGAGAAAGGAGGCCAGAGGG - Intergenic
1060818411 9:126647929-126647951 CCTGGGGACAGGAGGATGGAGGG - Intronic
1061253606 9:129440827-129440849 CCAGGTCTCAGAAGGACAGAGGG - Intergenic
1062194740 9:135266740-135266762 ACAGGAGCCAGGAGGACAGGAGG - Intergenic
1062196052 9:135274826-135274848 CCAGCAGGCAGGAGGAGAGAGGG - Intergenic
1062585828 9:137249531-137249553 GCAGGTGAAAGGAGGGCAGGAGG - Intergenic
1062724191 9:138062100-138062122 CTAGGTGAGAGGCAGACAGATGG - Intronic
1203692468 Un_GL000214v1:57662-57684 CCAGCTACCAGGAGGAAAGAGGG + Intergenic
1203556652 Un_KI270744v1:4554-4576 CCAGCTACCAGGAGGAAAGAGGG + Intergenic
1203643827 Un_KI270751v1:46529-46551 CCAGCTACCAGGAGGAAAGAGGG - Intergenic
1185515298 X:694832-694854 CCAGGTACCGGGAGGCCAGAAGG - Intergenic
1185830213 X:3294382-3294404 CCAGGTGGCTGGAGGACAAGGGG - Intergenic
1186647873 X:11526333-11526355 ACAGCTGACAGTAGGACAGCAGG - Intronic
1187373293 X:18728061-18728083 GCAGGTGAAAGGAGGACAGGAGG + Intronic
1188520438 X:31032458-31032480 GAAGGTGACAGGAGGCCACAGGG - Intergenic
1189280379 X:39816784-39816806 GCAGGGTACAGGAGGGCAGAAGG + Intergenic
1189980650 X:46506919-46506941 CCAGATGAGAGCAGGTCAGAAGG + Intronic
1190906709 X:54736057-54736079 CGAGGTGCCAGGATTACAGACGG + Intergenic
1192616859 X:72633993-72634015 TCAGATGACAGGAGAGCAGAAGG - Intronic
1193485552 X:82081553-82081575 CCAGGTGATAGGAGTAAATAGGG - Intergenic
1197763635 X:130045044-130045066 CCTGGGTACAGGAGGCCAGACGG + Intronic
1198412669 X:136387463-136387485 CCAGGTGAAAGGAGATCAAAGGG + Intronic
1198449708 X:136754807-136754829 TCTGGTGACAGGAGCACAGGAGG - Intronic
1200101560 X:153691188-153691210 CAAGGCTCCAGGAGGACAGATGG + Intronic
1200957935 Y:8970344-8970366 CCATGAGAGAGGAGGACAGCAGG - Intergenic
1201150234 Y:11091604-11091626 TCAGGTGCCAGGAGGACACCAGG + Intergenic
1201247730 Y:12022832-12022854 CCAGGTGGCTGGAGGACAAGTGG + Intergenic
1201530147 Y:14982973-14982995 CCAGGTGTCTGCAGGACTGAGGG + Intergenic