ID: 1148233721

View in Genome Browser
Species Human (GRCh38)
Location 17:45953306-45953328
Sequence CTCAAGGATGCTCCTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148233717_1148233721 5 Left 1148233717 17:45953278-45953300 CCTATTTTCTGCCTATGTCAAGT 0: 1
1: 0
2: 2
3: 13
4: 235
Right 1148233721 17:45953306-45953328 CTCAAGGATGCTCCTGAAAATGG 0: 1
1: 0
2: 0
3: 18
4: 227
1148233718_1148233721 -6 Left 1148233718 17:45953289-45953311 CCTATGTCAAGTAGCGCCTCAAG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1148233721 17:45953306-45953328 CTCAAGGATGCTCCTGAAAATGG 0: 1
1: 0
2: 0
3: 18
4: 227
1148233716_1148233721 25 Left 1148233716 17:45953258-45953280 CCAGGGACATCTTTCTGGGTCCT 0: 1
1: 0
2: 2
3: 15
4: 204
Right 1148233721 17:45953306-45953328 CTCAAGGATGCTCCTGAAAATGG 0: 1
1: 0
2: 0
3: 18
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148233721 Original CRISPR CTCAAGGATGCTCCTGAAAA TGG Intronic
902969491 1:20036994-20037016 CTCAAGGAGGCACCAGAGAAAGG - Intronic
905071630 1:35230945-35230967 CTCAAGGATTCTCCAGAATCAGG - Intergenic
905497533 1:38404364-38404386 CTCAAGGAGGCACCGGAGAATGG + Intergenic
906178918 1:43801192-43801214 CTCAATAATGCTCCTTAAATTGG + Intronic
906914775 1:49996263-49996285 CTCAAGGAGGCACCAGAGAAAGG + Intronic
907840702 1:58154657-58154679 GTCCAGAATGCTCCAGAAAAGGG + Intronic
912510615 1:110187784-110187806 TTCAAGAATGCTCCAGAAATGGG - Intronic
913036417 1:114970353-114970375 CTCAAGGAGGCACCAGAGAAAGG - Intronic
914776887 1:150745350-150745372 ATGAATGATGCTCATGAAAAGGG + Intronic
916681678 1:167110424-167110446 CTCAAGGAAGCACCAGAGAAAGG + Intronic
917651907 1:177086006-177086028 CTCCACAATGCTCCTGGAAAGGG + Intronic
918236584 1:182586271-182586293 CTCATGGACGCTGCTGAAAAAGG - Exonic
918328216 1:183430906-183430928 CTCAAGGATGCAGCTGTAAGTGG + Intergenic
920310514 1:205045560-205045582 CTCAAGGAGGTTTCTGAAGAGGG - Intronic
922909015 1:229199775-229199797 CTCAAGGGAGCTTCTGCAAAGGG + Intergenic
924740616 1:246792568-246792590 CTCCAGAATGCTCATGAAGAAGG - Intergenic
1063578647 10:7285132-7285154 CTTAAGAATGCCCCTAAAAAGGG - Intronic
1064519367 10:16185404-16185426 CTCAAGGATGCCCCAGAGAAGGG + Intergenic
1065640311 10:27775538-27775560 CTGAAGTATGCTCATGAGAAAGG + Intergenic
1069648247 10:70020414-70020436 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
1070606382 10:77901387-77901409 CTCCAGGATGCTACTGTAGATGG - Intronic
1077878261 11:6325756-6325778 ACCCAGGATGCTCCTGCAAATGG + Intergenic
1078436998 11:11333675-11333697 CTCTCTGATGCTCCTGAGAAAGG - Intronic
1079689357 11:23403358-23403380 CTCAAGGATGCTCAAAGAAAAGG + Intergenic
1079777651 11:24553885-24553907 CTCAAGGAAACTCATGAAAATGG - Intronic
1080456396 11:32423405-32423427 CTCAAGCCTGCTTCTGATAATGG + Intronic
1081632124 11:44696275-44696297 CTAAATGATGATCTTGAAAAGGG - Intergenic
1082723518 11:56707381-56707403 CTCAAGGATTTACATGAAAAAGG + Intergenic
1082963976 11:58947134-58947156 CTCAGGGATGCTCCTGGCCAAGG - Intronic
1084456166 11:69269279-69269301 CTGAAGGCTGCTCCTGGGAAGGG + Intergenic
1087948052 11:104188864-104188886 TTCAAGCTTACTCCTGAAAAGGG + Intergenic
1088916962 11:114234861-114234883 CCCCAGGTTGCTGCTGAAAAAGG - Intronic
1091622677 12:2101293-2101315 CTCAGGGTAGCTCCTGAGAAGGG + Intronic
1091625944 12:2121129-2121151 CTCCAGGATGCCTCTGCAAAAGG + Intronic
1094041292 12:26123447-26123469 CTCTAGGATGCTTCGGGAAATGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1096956490 12:55530893-55530915 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
1097009417 12:55941562-55941584 CTAAAGGATGGTCCTGAGATAGG + Exonic
1097302411 12:58033328-58033350 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1097607244 12:61769939-61769961 CTCAAGGAGGCACCAGAGAAAGG + Intronic
1098720790 12:73895096-73895118 CTTAAAGATGCTCCTCACAATGG + Intergenic
1099272772 12:80532710-80532732 CTCCCGACTGCTCCTGAAAAAGG + Intronic
1100056461 12:90517169-90517191 CCCTAGGAGGCTCCTCAAAATGG - Intergenic
1100206571 12:92356378-92356400 CCCTAGGATGCTTTTGAAAATGG + Intergenic
1100523545 12:95399315-95399337 CACAAGGGTCCTTCTGAAAAGGG + Intergenic
1100669398 12:96794679-96794701 CTCAAGGAGGCACCAGAGAAAGG - Intronic
1102481436 12:113226589-113226611 CTCAAGTATACTCTTTAAAATGG - Intronic
1104750725 12:131236476-131236498 CTCAAGGATGGTTCTGGAGATGG + Intergenic
1105148636 13:17230828-17230850 CTCAAAGCTGCTCTTGGAAACGG - Intergenic
1105314317 13:19243387-19243409 CTCAAGGAAGCACCAGAGAAAGG + Intergenic
1105990314 13:25614455-25614477 CTCAAGGAGGCACCAGAGAAAGG - Intronic
1106046224 13:26144622-26144644 TTCAAGGATGCCCCAGAAAGGGG + Intronic
1106098719 13:26675015-26675037 CTCCGGGATGCCTCTGAAAACGG + Intronic
1107426699 13:40301295-40301317 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1107954884 13:45502120-45502142 GTCAAGGCAGCTCCTGCAAATGG - Intronic
1108909415 13:55525635-55525657 CTCATAGAGGCACCTGAAAAAGG - Intergenic
1109256515 13:60089830-60089852 CTTAAGGATGCTCCTTTGAATGG + Intronic
1109508298 13:63336206-63336228 ATCAAGGAGGCACCAGAAAAAGG - Intergenic
1109725825 13:66340547-66340569 CTCAAAGATGTTCTTCAAAAAGG + Intronic
1109933249 13:69244761-69244783 TTCAAGGATGTCCCAGAAAATGG + Intergenic
1110095501 13:71513993-71514015 GTAAAGGCAGCTCCTGAAAATGG + Intronic
1110198486 13:72819343-72819365 ATGAAGCATACTCCTGAAAAGGG - Intronic
1111691126 13:91564464-91564486 CCCAAGGATGCTACTTGAAATGG - Intronic
1112586520 13:100723338-100723360 CTGACAGAGGCTCCTGAAAATGG + Intergenic
1112703271 13:102036451-102036473 CTCGAGGGTGCTCCTGAAATGGG + Intronic
1113446762 13:110374837-110374859 CTCAGGAATGCTTCTGAAGAGGG - Intronic
1115393105 14:32876613-32876635 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1116055696 14:39861652-39861674 TTCAAGGATACTCCAGAATAAGG - Intergenic
1118140085 14:63071552-63071574 ATCAAGGAGGCTCCAGAGAAAGG - Intronic
1118203831 14:63703248-63703270 CTTTAGGATGCTACTGAAAGTGG - Intronic
1119024982 14:71145480-71145502 GTCAAAGATGCTGCTGAAAATGG - Intergenic
1120496628 14:85245910-85245932 GTCAAGGATGCTGCTAAACACGG - Intergenic
1122745754 14:103896415-103896437 CTCACGGATCCTCCTGGAAGGGG - Intergenic
1124616421 15:31245548-31245570 CTCCAGGATGCTCCTGCATGGGG - Intergenic
1130460672 15:84156681-84156703 TCCCAGGATGCTCCTCAAAATGG + Intergenic
1130782129 15:87051480-87051502 GACATGGAGGCTCCTGAAAATGG + Intergenic
1131663297 15:94541856-94541878 CTCATGAATGGTCTTGAAAATGG - Intergenic
1133641929 16:7725424-7725446 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1137037408 16:35578326-35578348 CTCAAGGATGCTCCTAAGGACGG - Intergenic
1137256960 16:46783521-46783543 CTCCAGGATGCCCCCCAAAATGG - Intronic
1138078351 16:54064980-54065002 TGCAAGGATGCTCCTGGAAGTGG + Intronic
1138387367 16:56644749-56644771 CCCAGGGCTGCACCTGAAAAGGG + Intronic
1139799008 16:69506040-69506062 GTCAAGGCTGCTCTTGACAATGG - Intergenic
1146609354 17:34290686-34290708 CTGCAGGATGCTCCTGGAAGAGG + Intergenic
1148233721 17:45953306-45953328 CTCAAGGATGCTCCTGAAAATGG + Intronic
1149129331 17:53277937-53277959 CTAAGGGCTGCTCCAGAAAAGGG + Intergenic
1156695419 18:39760612-39760634 CACAAGTATGCTCCTGAGAGAGG + Intergenic
1161553471 19:4927629-4927651 CCTAAGGATGCTCCTGAACCAGG + Intronic
1162841890 19:13362861-13362883 CTGAGGAATGCTACTGAAAACGG + Intronic
1164544602 19:29149513-29149535 GTCAAGGATGACCCTGAGAATGG + Intergenic
1164929582 19:32165272-32165294 CCCAGGGATGCTCCTGGCAAGGG + Intergenic
1165358689 19:35320126-35320148 CTCCAGGCTGCTCCTTAAACAGG + Intronic
1166424135 19:42661193-42661215 CTCTAAGATGCTCTTGGAAAGGG + Intronic
1167331629 19:48859760-48859782 CACAAGGATGCACCCAAAAAAGG + Intronic
1167369110 19:49070393-49070415 CTCAGGGATGCTAGTGAAATGGG + Exonic
1167612874 19:50515594-50515616 CTCAAGGCTGCTCCAGAGGACGG - Intergenic
1168222989 19:54974490-54974512 TTCAAAGCTGCTTCTGAAAAAGG - Exonic
1168344423 19:55643468-55643490 CGCAAGGAAGAGCCTGAAAATGG - Exonic
926832333 2:16977239-16977261 CTAAATGATGCTTCTGCAAAAGG - Intergenic
927071710 2:19537152-19537174 ATCAAGGAGGCACCAGAAAAAGG + Intergenic
927080073 2:19618286-19618308 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
928931275 2:36626989-36627011 CTCATGTCTGGTCCTGAAAAGGG - Intronic
929111723 2:38410466-38410488 CTCATGGATGTTGTTGAAAACGG + Intergenic
931235584 2:60410258-60410280 CTCAAGGATGCTTTAGGAAAGGG - Intergenic
934588694 2:95527331-95527353 CTCTAGGATGCTCCCAGAAAGGG + Intergenic
935007242 2:99090475-99090497 ATCAAGGAGGCACCAGAAAAGGG + Intronic
935902901 2:107811410-107811432 CTCAAGGAGGCTCTTGGGAAAGG - Intergenic
939148073 2:138440613-138440635 CTAAAGGATTTTTCTGAAAAGGG - Intergenic
939744937 2:145957076-145957098 CTCAAGGAGGCACCAGAGAAGGG - Intergenic
944187760 2:196968273-196968295 CTCAAGGATGTTACTGAAATTGG + Intronic
945362436 2:208907542-208907564 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
948614743 2:239191278-239191300 CTCAGGGATGCACCTGGACAAGG - Intronic
1169405728 20:5319408-5319430 CTCAAAGATACTCCCTAAAAGGG + Intergenic
1170386045 20:15818094-15818116 CTCAAGGCTGTTGCTGGAAAGGG + Intronic
1170650865 20:18239771-18239793 ATCAAGGAGGCACCAGAAAAAGG + Intergenic
1175520049 20:59596856-59596878 CTCAGGGAAGCTCCAGGAAATGG - Intronic
1175933246 20:62503269-62503291 GTCAAGGATGCTGCTGAGGAGGG - Intergenic
1177127849 21:17217852-17217874 ATCAAGGAGGCACCAGAAAAAGG + Intergenic
1184866839 22:47206058-47206080 CTCAGGGATCCTCCTGCAACAGG - Intergenic
949513829 3:4789379-4789401 CTCCAGGATCCTCATGAACATGG + Intronic
951325972 3:21302229-21302251 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
952183114 3:30940686-30940708 CTCAAGGAGGCACCAGAAAAAGG - Intergenic
952703340 3:36349424-36349446 CTCAAAGAGGCACCTGAGAATGG + Intergenic
954881854 3:53841772-53841794 TTCTAGTGTGCTCCTGAAAATGG + Intronic
959292060 3:104486600-104486622 CACAAAGATACTCCTGAAGAAGG + Intergenic
963960364 3:151303158-151303180 CTGAATGATGCTGGTGAAAAGGG + Intronic
964035448 3:152190595-152190617 CTCATGGCTGCTACTGAGAATGG - Intergenic
964325094 3:155536374-155536396 CTCAAGGATGCACCAGAGACAGG + Intronic
964772700 3:160240559-160240581 CTCAAGGAGGCACCAGAAAAAGG + Intronic
967111689 3:186299247-186299269 ATCAAGTAGGCTCCTGCAAAGGG - Intronic
967570808 3:191026301-191026323 TTCAGGGATGTCCCTGAAAAGGG + Intergenic
968285107 3:197503992-197504014 CTCTAGGATGAGCCTGAAAGTGG + Intergenic
970288022 4:14539726-14539748 CTCAAGGAGGCTCCTGTATAGGG - Intergenic
970591352 4:17563061-17563083 CTCGTGGATGCTCATGGAAAAGG + Intergenic
970867232 4:20773010-20773032 CTCAGGGCTGCTCCTGGAAATGG - Intronic
971554838 4:28001379-28001401 ATCAAGGAGGCACCTGAGAAAGG - Intergenic
973342945 4:49025294-49025316 ATCAAGGAGGCACCAGAAAAAGG - Intronic
974165175 4:58191904-58191926 ATCAAGGAGGCACCAGAAAAAGG + Intergenic
974472205 4:62332489-62332511 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
975311032 4:72904189-72904211 CTCAAGGAAGATACTGTAAAAGG - Intergenic
975397597 4:73895151-73895173 CTCAAGCATGCACATTAAAATGG + Intergenic
977929907 4:102738802-102738824 CTCAAGGAGGCACCAGAGAAAGG + Intronic
978288285 4:107105345-107105367 CTGAAGGTAGTTCCTGAAAAAGG - Intronic
978488170 4:109279813-109279835 CTCCAGGATGCTGGAGAAAAAGG - Intronic
979281665 4:118875588-118875610 ATCTAGCATGTTCCTGAAAAGGG + Intronic
980389420 4:132123875-132123897 CACAAGGACGCCCATGAAAATGG + Intergenic
980519196 4:133909368-133909390 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
982049996 4:151490697-151490719 CTCAAGGAGGCACCAGAGAAAGG + Intronic
982330947 4:154181687-154181709 CTCAAGGATTCTGCTGTAATTGG - Intergenic
982800189 4:159696841-159696863 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
983094820 4:163549372-163549394 CTCAAGGAAGCTGGTGGAAATGG + Intronic
983277561 4:165636459-165636481 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
986944873 5:13004824-13004846 CTAAGGGATGCTCCTGCAATAGG - Intergenic
987015388 5:13812700-13812722 ATCAAGGATATTCATGAAAATGG + Intronic
987030291 5:13971213-13971235 CTCAAGGAGGCACCAGAAAAAGG - Intergenic
988278324 5:29112771-29112793 CTCAAGGAGGCACCAGAAAAAGG - Intergenic
988725064 5:33918877-33918899 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
988834099 5:35014543-35014565 CTACAGGATGCTCATGATAATGG - Intronic
991197244 5:63949883-63949905 CTCAAGGAAGCACCTGTAATTGG - Intergenic
991646596 5:68807524-68807546 CTCAAGGTTTATACTGAAAAAGG + Intergenic
992239562 5:74753110-74753132 CTCAAGGAGGCACCAGAGAAAGG + Intronic
992504060 5:77368089-77368111 CTAAATGCTGCTACTGAAAATGG - Intronic
994736235 5:103560112-103560134 CTCAATGAAACTTCTGAAAATGG - Exonic
994778051 5:104060753-104060775 CTCAAGGAGGCACCAGAGAATGG - Intergenic
994837147 5:104870608-104870630 CTCAACTTTGGTCCTGAAAATGG + Intergenic
996025403 5:118639490-118639512 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
996110346 5:119558418-119558440 CTCAAGGAGGTACCAGAAAAAGG - Intronic
996288119 5:121819208-121819230 CTAAAAGATACTCCTGAGAATGG - Intergenic
996326867 5:122285575-122285597 CTCAAGGAAGCACCAGAGAAAGG - Intergenic
998094453 5:139389408-139389430 CTCAAGGATGGGCCTGGAAAGGG + Intronic
1002871059 6:1167646-1167668 CTGGAGGATGTTCCAGAAAAGGG - Intergenic
1004096664 6:12561423-12561445 CTCAAGGAGGATCCAGAGAAAGG + Intergenic
1004175438 6:13335745-13335767 CTCAAGCAGGCTTCTGAACATGG - Intergenic
1004267642 6:14163049-14163071 CAGAAGGCTGCTCCTGAAAGTGG - Intergenic
1005217728 6:23551346-23551368 CTCAAGCAAGTTCCTGAGAATGG - Intergenic
1007605860 6:43117543-43117565 GTCAAGGATGCCCCAGTAAATGG - Intronic
1008781359 6:55109421-55109443 CTCAAGGAGGCACCAGAGAAAGG + Intronic
1009332391 6:62440478-62440500 ATCAAGGATGCACCAGAGAAAGG - Intergenic
1010500620 6:76594691-76594713 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
1011981945 6:93389529-93389551 CTCAAAAAGTCTCCTGAAAATGG + Intronic
1014278476 6:119415699-119415721 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1015644093 6:135367791-135367813 CTCAAGGAGGCACCAGAGAAAGG - Intronic
1016496989 6:144674889-144674911 CTCAAGGAGGCACCAGAGAAAGG - Intronic
1016910015 6:149189730-149189752 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1018442543 6:163826296-163826318 CACACAGATGCCCCTGAAAACGG - Intergenic
1019062323 6:169265414-169265436 CTCAGGGATGCATTTGAAAAAGG - Intergenic
1021196471 7:17679779-17679801 CTTCAGGATGCTGCTGGAAAGGG - Intergenic
1025239649 7:57260452-57260474 CTCATGGATGCTCCTGAGTTTGG - Intergenic
1026141283 7:67709124-67709146 CTCAAGGCTGCTTCTGAGAGAGG + Intergenic
1027820094 7:83031911-83031933 ATCAAGGGTAGTCCTGAAAAGGG - Intronic
1027963746 7:84980294-84980316 ATCAAGGAGGCACCAGAAAAAGG - Intergenic
1028782991 7:94758121-94758143 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
1030802252 7:113866386-113866408 TTTATGAATGCTCCTGAAAATGG - Intergenic
1030861434 7:114636168-114636190 CTGAAGGATACTCCAGAAACTGG + Intronic
1032044462 7:128592750-128592772 CTGAAAGATGCCCCTGAAAGTGG - Intergenic
1032343943 7:131102601-131102623 CTCTACTCTGCTCCTGAAAAAGG + Intergenic
1032448798 7:132009127-132009149 ATCAAGGATGCGCCAGAGAAAGG - Intergenic
1032605154 7:133342962-133342984 CTCAAGGAGGCACCAGCAAAAGG - Intronic
1034058784 7:148067042-148067064 CTCAAGGAGGCACCAGAGAAAGG - Intronic
1038004189 8:23416226-23416248 CTCAAAGATGCAGCTGAAAGAGG + Intronic
1038908873 8:31938609-31938631 ATCAAGGAGGCACCAGAAAAAGG + Intronic
1039642479 8:39238630-39238652 CTCAAGGAGGCACCAGAGAAAGG + Intronic
1039787469 8:40846625-40846647 ATGCAGGATGCTCCTGGAAACGG - Intronic
1043679035 8:82997839-82997861 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
1047162083 8:122391987-122392009 CTTAAAGAGTCTCCTGAAAATGG - Intergenic
1047227204 8:122967090-122967112 CTCAAGGAGGCACCAGGAAAAGG - Intronic
1047698054 8:127422853-127422875 ATTAAGGATGCACTTGAAAATGG + Intergenic
1047937394 8:129796348-129796370 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1049487045 8:142871160-142871182 CTGAAGGATGCTGCTGGTAAGGG + Intronic
1050133793 9:2440789-2440811 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1050848314 9:10252488-10252510 CTCAGGGTTTCTCATGAAAATGG - Intronic
1051601233 9:18877182-18877204 CTCAAGGAGGCACCAGAGAAAGG - Intronic
1051922932 9:22288822-22288844 CTGACAGCTGCTCCTGAAAATGG - Intergenic
1053247763 9:36548967-36548989 ATCAAGGAGGCACCAGAAAAAGG + Intergenic
1053540073 9:38964226-38964248 CTGAATGATGCACTTGAAAATGG + Intergenic
1053804422 9:41786383-41786405 CTGAATGATGCACTTGAAAATGG + Intergenic
1054140861 9:61529079-61529101 CTGAATGATGCACTTGAAAATGG - Intergenic
1054192730 9:61997875-61997897 CTGAATGATGCACTTGAAAATGG + Intergenic
1054626068 9:67399693-67399715 CTGAATGATGCACTTGAAAATGG - Intergenic
1054645675 9:67590816-67590838 CTGAATGATGCACTTGAAAATGG - Intergenic
1055125899 9:72718143-72718165 ATCAAGGAGGCACCAGAAAAAGG - Intronic
1055179197 9:73362548-73362570 CTCAAAGTTCCTCGTGAAAACGG - Intergenic
1055846645 9:80572786-80572808 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
1056396719 9:86187752-86187774 ATCAAGGATGCACCAGAAAAAGG + Intergenic
1057733845 9:97634284-97634306 TTCAAAGCTGCACCTGAAAAGGG + Intronic
1187782641 X:22845456-22845478 CTGTAGGATTCCCCTGAAAATGG - Intergenic
1188389239 X:29599956-29599978 ATCAAGGATGCACCAGAGAAAGG - Intronic
1191679146 X:63824387-63824409 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1192853492 X:74981986-74982008 CTCAAGGGGGCACCAGAAAAAGG + Intergenic
1192900153 X:75487730-75487752 CTCAAGGAGGCACCAGACAAAGG + Intronic
1192944913 X:75956399-75956421 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1193314932 X:80054304-80054326 CTCAAGGAGGCACCAGAAAAAGG - Intergenic
1193950818 X:87795821-87795843 ATCAAGGAAGCACCAGAAAAAGG + Intergenic
1194095214 X:89631519-89631541 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1194168211 X:90548665-90548687 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
1194438961 X:93905890-93905912 CTGAAGGAGGTTCCTGAAAAAGG - Intergenic
1194474145 X:94336760-94336782 CTCAATGATTCTCCTGAAGAAGG + Intergenic
1194516077 X:94855435-94855457 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
1194553899 X:95333787-95333809 CTCAAGGAGGCACCAGAGAATGG + Intergenic
1196388505 X:115185879-115185901 CTACAGGATTCTACTGAAAAAGG + Intronic
1197081630 X:122425689-122425711 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1197910760 X:131480384-131480406 CTCAAGGAGGCACCAGAGAAAGG + Intergenic
1198604426 X:138321690-138321712 ATCAAGGAGGCACCTGAGAAAGG - Intergenic
1199780096 X:151050604-151050626 CTCCAGGAAGCTCAAGAAAAAGG - Intergenic
1200447848 Y:3287697-3287719 CTCAAGGAGGCACCAGAGAAAGG - Intergenic
1200514454 Y:4126447-4126469 CTCAAGGAGGCACCAGAGAAAGG + Intergenic