ID: 1148235181

View in Genome Browser
Species Human (GRCh38)
Location 17:45964002-45964024
Sequence CTCTGGGTGAGGAGGTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 715
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 655}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148235181 Original CRISPR CTCTGGGTGAGGAGGTGAGA GGG Intronic
900193204 1:1360099-1360121 CTCTGGGTGCAGGGCTGAGAGGG + Intronic
900277174 1:1838320-1838342 GTCTGGGTGAGGAGGGTACATGG - Intronic
900388094 1:2419723-2419745 CTCTGGTGGAGGTGGTGACATGG + Intergenic
900585889 1:3432171-3432193 CTCTGGCTGAGGAGGCCAGGTGG - Intronic
900882965 1:5394959-5394981 CTCTGAGTGAGATGGTGACATGG - Intergenic
901525779 1:9822983-9823005 CTTTGGGTGAAAAGGTGGGAGGG + Intronic
901664807 1:10820088-10820110 CTCAGGGTGAGGAGGAAACAAGG + Intergenic
901798619 1:11694351-11694373 CTCTGGCTGGGGAGGTTGGAGGG + Intronic
901879078 1:12183309-12183331 CTCTGGGAGACGAGGGGAGGTGG + Intronic
902527220 1:17067048-17067070 CACTGGGTGGGCAAGTGAGATGG + Exonic
902731140 1:18369627-18369649 CTCTGGGTGAGACAGTGGGACGG + Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
903739790 1:25552134-25552156 CTCTAGGATAGGAGCTGAGAGGG + Intronic
904034007 1:27549527-27549549 CTCTGGGCGAGAGGCTGAGAGGG + Exonic
904035703 1:27557379-27557401 CTCTGGGGAAGGAGGTGGGCGGG - Intronic
904563925 1:31415918-31415940 CTTTGGATGGGGAGGTAAGATGG + Intronic
904680292 1:32224285-32224307 TTCTGGATAAGGAGGTAAGAGGG + Intronic
904954278 1:34269976-34269998 CTTTGTGTGGGGAGGAGAGAAGG + Intergenic
904956125 1:34285302-34285324 TAGCGGGTGAGGAGGTGAGAAGG - Intergenic
905279366 1:36839130-36839152 GGCTGGGTGCGGAGGTGAGCAGG - Intronic
905653830 1:39673115-39673137 CTCTGACTGGGGAGGTGAGGGGG + Intergenic
906412654 1:45591648-45591670 TACAGGGGGAGGAGGTGAGACGG - Intronic
906644734 1:47466229-47466251 CACTGGGTCAGGAGGTAAGCAGG - Intergenic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908175646 1:61552754-61552776 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
909260529 1:73483407-73483429 CTCTGGGTTATGAAGTGAGTAGG - Intergenic
909596710 1:77413864-77413886 CTCTGGGTGAGAAGGGGAAGTGG - Intronic
910640584 1:89457185-89457207 CTTTGGGTGAGTAGGGCAGATGG + Intergenic
911027223 1:93448300-93448322 CTGTGGGTGAGTCGGGGAGAGGG + Exonic
912239859 1:107894985-107895007 CTTTGGCAGTGGAGGTGAGAGGG - Intronic
912705977 1:111913026-111913048 CTCTGGGTGAGGCTGTGTGAGGG - Intronic
913083252 1:115409627-115409649 CACTGGGTGAGGAGATGGGGAGG - Intergenic
914812267 1:151037657-151037679 CCCTAGGTGAGGACGTGTGAGGG + Exonic
915167143 1:153954269-153954291 CTCTGGGGGAGGAGATAAGTAGG + Exonic
915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG + Intergenic
916370712 1:164091287-164091309 ATATGGGAGAGGAGATGAGAAGG + Intergenic
916749726 1:167713501-167713523 CTCTCGGTTAGCAGGTGACAGGG + Intergenic
916936441 1:169632926-169632948 TTCTTGGTGAGGGGGTGTGAGGG - Intergenic
917471604 1:175330536-175330558 GTTTGGCAGAGGAGGTGAGAGGG - Intronic
918367949 1:183828893-183828915 CTATGGGTGAGGAAGAGAGTTGG + Intronic
919932251 1:202228973-202228995 ATCTGGTTAAGGAAGTGAGAAGG + Intronic
919964640 1:202510362-202510384 TTCTGGATAAGGAGGTGACATGG + Intronic
919977685 1:202623398-202623420 CTCTGGAGAAGGAGGTGGGAAGG - Intronic
920227191 1:204447342-204447364 CTTTGGGAGTGGAGGTGGGAAGG - Intronic
920437106 1:205954150-205954172 CCTTGGGAGAGGAGCTGAGAGGG + Intergenic
920699879 1:208209700-208209722 ATCTGGGTGGGGAGCTGGGAAGG + Intronic
920793299 1:209113368-209113390 ATCTGGGGGCGGAGGTTAGAAGG - Intergenic
921934935 1:220787258-220787280 CTCGGGGCAAGGGGGTGAGAAGG + Intronic
922209873 1:223478906-223478928 GCGGGGGTGAGGAGGTGAGAGGG + Intergenic
922209885 1:223478938-223478960 GGGGGGGTGAGGAGGTGAGAGGG + Intergenic
922209889 1:223478954-223478976 GAGAGGGTGAGGAGGTGAGAGGG + Intergenic
922209925 1:223479048-223479070 TGGGGGGTGAGGAGGTGAGAGGG + Intergenic
922343602 1:224677605-224677627 CTCTAGGTGAGGCGCTGAGGTGG + Intronic
923244088 1:232114212-232114234 CTCTGGGTGAGTCAGTGAGTGGG - Intergenic
923434007 1:233951369-233951391 CTCTGGGTGAGTCAGTGAGTGGG - Intronic
923667461 1:236011694-236011716 CCCTGGGAGAGAAGGTGAGGCGG - Intronic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924510403 1:244725152-244725174 CACTGGGGGGTGAGGTGAGATGG + Intergenic
924581817 1:245330283-245330305 CTCTTGGGGAGGGGGTGTGAGGG + Intronic
924638718 1:245812946-245812968 GTTGGGGTGAGGAGGTGAGGAGG + Intronic
924857181 1:247885196-247885218 CTCTGGGTGAGTCAGTGAGTGGG + Intergenic
924938822 1:248795657-248795679 CACTGTGTGAGTTGGTGAGAGGG + Intergenic
1063045861 10:2392241-2392263 CACTGGGTGAGGAGGGGACGGGG + Intergenic
1063377459 10:5562512-5562534 CTCTGAGGGAGGAGGAGGGAGGG - Intergenic
1063395744 10:5685306-5685328 CTCCGGGTGAGGGGGTGGGAGGG + Intronic
1064143232 10:12807522-12807544 GGCAGGGTGAGGAGGAGAGAGGG - Intronic
1064445972 10:15393232-15393254 ATCTGGGGGAGGAGGAGAGAAGG + Intergenic
1064995192 10:21290691-21290713 CTCTGGGGGAGGTGGTGGTAAGG - Intergenic
1065686648 10:28291964-28291986 CTCTGGGTGAGTCAGTGAGTGGG - Intronic
1065997367 10:31071359-31071381 CTCTGGCTGGGCAGGTGAGCAGG + Intergenic
1067478134 10:46579377-46579399 CACTGGGTGGGGTGGTGAGAAGG - Intronic
1067576483 10:47411986-47412008 CTCAGGGACAGGAGGAGAGATGG - Intergenic
1067616606 10:47762410-47762432 CACTGGGTGGGGTGGTGAGAAGG + Intergenic
1067715174 10:48685145-48685167 ATGTGGGAGAGGAGGTGAGCTGG + Intronic
1069506289 10:69001185-69001207 CTCTGGTTAAGCAGGTTAGAAGG + Intronic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070851278 10:79563461-79563483 CTCAGGGTAGTGAGGTGAGAGGG - Intergenic
1071602787 10:86967002-86967024 CTCTGGGAGAGGAGGGGCGGGGG + Intronic
1071945235 10:90636266-90636288 CTGGGGGTGAGGAGCTGAAAAGG + Intergenic
1073702500 10:105944221-105944243 CTCTGTGAGAGGAGGTTAGAGGG + Intergenic
1073716054 10:106108756-106108778 CTCTAGGGGAGGTGGTGAGAAGG - Intergenic
1074259958 10:111842512-111842534 CTCTGGGTGAGTGGGTGAGTGGG + Intergenic
1074437650 10:113447636-113447658 GTCTGGGATAGGAGGTGAGGTGG - Intergenic
1074810402 10:117099225-117099247 CTCAGGGTGGGGAGGTAAGGAGG + Intronic
1074850181 10:117433126-117433148 CTTTGGTTTAGGGGGTGAGAAGG + Intergenic
1075345803 10:121681225-121681247 ATCTGAGTGAGGTGGAGAGAAGG + Intergenic
1075562432 10:123478023-123478045 TTCTGGGTGCTGAGGTGAGGAGG + Intergenic
1075673389 10:124279720-124279742 CCCTGGCTGAGGAGGTGAGTGGG - Intergenic
1075777704 10:124998973-124998995 CTCTGGCTGAGGAGGGTAAATGG - Intronic
1075864845 10:125709011-125709033 CTCTGGGGGAGGTGTTGGGAAGG - Intergenic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076291505 10:129349303-129349325 CACTGGGGGAGGAGATGAGTGGG - Intergenic
1076359596 10:129877996-129878018 CTCTGGGAGAGGCGGCGAGGAGG + Intronic
1076600604 10:131654718-131654740 CCCTGTGTGAGGAGCAGAGACGG - Intergenic
1076787221 10:132757278-132757300 CTCGGGGTGAGCTGGTGAGCGGG - Intronic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1076931358 10:133534004-133534026 CTCATGGTGATGTGGTGAGATGG + Intronic
1077194467 11:1272337-1272359 GTCTGGGTGGGGAGGCGAGGAGG + Intergenic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1078172269 11:8937343-8937365 CTCTGGCCGAGCATGTGAGAAGG + Intergenic
1078930388 11:15907919-15907941 CTCTGGGTGAGGAGAAGCCATGG + Intergenic
1079466538 11:20736260-20736282 CTCACGGTGGGCAGGTGAGAGGG + Intronic
1080019594 11:27546108-27546130 GTCTGTGTGAGGAGAGGAGATGG + Intergenic
1080029516 11:27646206-27646228 CCCTGGGTCAGCTGGTGAGAGGG - Intergenic
1081630795 11:44688332-44688354 ATGTGGGTGAGGAAGAGAGAGGG - Intergenic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1083151680 11:60795546-60795568 CTCTGGATGTGGACCTGAGAGGG - Exonic
1083269214 11:61562849-61562871 ATCTTGCTGAGGAGATGAGAAGG - Intronic
1083663539 11:64262995-64263017 ACCAGGGTGAGAAGGTGAGATGG + Intronic
1083827742 11:65212698-65212720 CTCCCAGTGAGGAGGTGACAAGG - Intergenic
1084065311 11:66700700-66700722 CCCTGGGCGAGGAGGTGACCCGG - Exonic
1084122710 11:67078508-67078530 CTCAGGGTGAGGAGGAGGGTGGG + Intergenic
1084321962 11:68378090-68378112 GGCTGGGTGATGAGGTGGGATGG + Intronic
1084470089 11:69354261-69354283 CCCTGGCTGAGGCGGTCAGAGGG - Intronic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084678182 11:70649114-70649136 ATATGGGTGAGAAGGGGAGATGG - Intronic
1084876230 11:72135783-72135805 CGCTGCGTGTAGAGGTGAGAGGG - Intronic
1084881100 11:72172279-72172301 CGCTGCGTGTAGAGGTGAGAGGG - Intergenic
1084915807 11:72428186-72428208 CTTTGGGTGAGGGGGAGGGAAGG + Intronic
1085403063 11:76246016-76246038 CACTGGCTGAGGGGGTGAGAGGG + Intergenic
1086846988 11:91762805-91762827 CTCTGCTCGAGGAGATGAGATGG - Intergenic
1086917488 11:92547625-92547647 CTGGGGGTGAGAAGGGGAGAGGG - Intronic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1087137383 11:94734654-94734676 CCCTGGGAGAGGAGGGGAGGAGG + Intronic
1087466411 11:98512250-98512272 CTATTGGTGAGGAGGTAAAATGG - Intergenic
1087805926 11:102555362-102555384 CTCGGAGGGAGGTGGTGAGAAGG - Intergenic
1088375846 11:109140879-109140901 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
1089012378 11:115141750-115141772 ATCTGGGTGGGGAAGTGGGAGGG - Intergenic
1089151183 11:116365657-116365679 CTCAGGGTGAGGATGGGAGAGGG - Intergenic
1089610364 11:119665296-119665318 TTCTGGGTGAGGAAAAGAGATGG + Exonic
1090041136 11:123292832-123292854 CTCTGGGTGAGTCAGTGAGCAGG + Intergenic
1090447707 11:126778107-126778129 CTCTGGGTGGGGAGGTCAGGGGG - Intronic
1090481829 11:127075765-127075787 CTCTGAGAGAGGGGTTGAGAGGG - Intergenic
1090879455 11:130820873-130820895 CTGAGGGTGAGGAGGTCAGCTGG - Intergenic
1091104176 11:132902956-132902978 CTCTGGGGGAGGTGGTGCAAAGG - Intronic
1091108743 11:132945496-132945518 CTCTGGGTGAGTCAGTGAGCGGG + Intronic
1091310590 11:134572871-134572893 CTCTGCGTGGAGGGGTGAGAGGG - Intergenic
1091400607 12:178522-178544 CTCTTGGTGAGGATTTGAGAAGG + Intergenic
1092698346 12:11199453-11199475 TGCTTGGTGAGGAGGTCAGATGG - Intergenic
1093479894 12:19593439-19593461 CTCTGGGAGGCGAGGTGAAATGG + Intronic
1094416293 12:30219174-30219196 CTCTGGGTGAGTCAGTGAGTGGG - Intergenic
1095227463 12:39694845-39694867 CTCTGCTTGAGGAGAGGAGAAGG + Intronic
1096085986 12:48865413-48865435 CTCTGGGTGAAGAGGTGAGGAGG + Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096521887 12:52189146-52189168 CTCTGGGTAAAGAGAGGAGAGGG - Intronic
1096522954 12:52194426-52194448 GACGGGGTGAGGAGGGGAGAGGG - Intergenic
1096526741 12:52214566-52214588 CAGTGGGTGAGCAGGTGAGGTGG - Intergenic
1096911909 12:54992419-54992441 CTCTGGGTGAGTGAGTGAGTGGG + Intergenic
1096994920 12:55832420-55832442 CCCTGGCAGAGGAGGTGAGATGG - Intergenic
1097265289 12:57740760-57740782 GTATGGGACAGGAGGTGAGAGGG + Intronic
1098512979 12:71341014-71341036 CTCTTGGTGGGGTGGGGAGAGGG - Intronic
1098769693 12:74537839-74537861 GGCTGGGTGAGGCGCTGAGACGG + Exonic
1099922675 12:88978584-88978606 CACTGGGTGAGGTGGGGACAGGG + Intergenic
1100001583 12:89843434-89843456 CTGTAGCTGAGGAGGTGAGGAGG - Intergenic
1100854633 12:98748287-98748309 CTAAGGGTGAGGAGGTGAGCAGG + Intronic
1101157053 12:101937773-101937795 CTCTGGGAGGGGTGGTGAAAAGG - Intronic
1101706297 12:107224138-107224160 CTGGGGGTGAGGAGTGGAGAGGG + Intergenic
1102151514 12:110691583-110691605 CTCTGGTTGAGGAAGGGAAAAGG + Intronic
1102508523 12:113398939-113398961 CCCAGGGTGGGGAGGTGAGGGGG - Intronic
1102627125 12:114244085-114244107 CTCTTGGTGGGGAAGTGACAAGG + Intergenic
1103043793 12:117718530-117718552 GTCTGCCTGAGGAGGTGACAAGG - Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103889647 12:124228766-124228788 GTCTGGGTGACGAGGTGAATGGG + Intronic
1104630858 12:130400962-130400984 CTTTTGGTGGGAAGGTGAGATGG + Intronic
1104681795 12:130757206-130757228 CTCTGGAGGAGGAGATGACAAGG + Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1106093943 13:26625687-26625709 CTCTGGGTGAGTCTGTGAGAGGG - Intronic
1106635619 13:31525610-31525632 CTCAAAGAGAGGAGGTGAGATGG - Intergenic
1107526581 13:41238473-41238495 GTGTGGGGTAGGAGGTGAGAAGG + Intronic
1107611784 13:42121665-42121687 CTATGGGTGTAGTGGTGAGAAGG - Intronic
1107722629 13:43264925-43264947 TTCTGGGTGAGGAACAGAGAAGG + Intronic
1107928579 13:45287678-45287700 TTCTTGGTTTGGAGGTGAGATGG - Intergenic
1107987882 13:45791554-45791576 TTCTGGGTGAGGAGCTGCCAGGG - Intronic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1110290749 13:73804094-73804116 AAGTGAGTGAGGAGGTGAGATGG - Intronic
1110949378 13:81465182-81465204 CTCTGGGCGAGGAGCCAAGATGG - Intergenic
1110982853 13:81924176-81924198 CTCTGGGTGATGGGGTAGGACGG - Intergenic
1113056681 13:106275601-106275623 TTCTGGGTTAGGAGGCAAGAAGG - Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113575267 13:111390743-111390765 CTCTGCCTGAGGAGGTGTGAGGG + Intergenic
1113856060 13:113446073-113446095 CTCTGTGGTAGGAGGTGAGGAGG - Intronic
1114317683 14:21523345-21523367 CTCAGAGAGTGGAGGTGAGAAGG - Exonic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1115163879 14:30426264-30426286 CTCTGCCTGAGGAGGTGGCATGG + Intergenic
1117094213 14:52281226-52281248 CACTAGGTAAGGAGGTGAGTTGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117636505 14:57750037-57750059 CTCAGGGTGAGGAGATGAGAGGG - Intronic
1117795478 14:59388964-59388986 CTCTGCTTGAGGAGAAGAGAGGG - Intergenic
1117850890 14:59968265-59968287 CTCTGGGAGAGGAGGAGGTAGGG + Intronic
1118372955 14:65153313-65153335 CTCCGGGTGGGGAGGAGAGGCGG - Intergenic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1118704081 14:68463856-68463878 TCCTGGGTGAGGAGGAGAGCAGG + Intronic
1119172845 14:72547682-72547704 CAATGGGTGGGAAGGTGAGACGG + Intronic
1119304435 14:73596193-73596215 CTCTTAGAGAGGAAGTGAGAGGG - Exonic
1119531654 14:75365699-75365721 CACTGGGGGAGGTGGTGGGAAGG + Intergenic
1119851695 14:77870948-77870970 CTCTGGGTCACGAGGAGACAGGG - Intronic
1120364132 14:83543359-83543381 CTCTGGAAGAGCAGGTGAGATGG + Intergenic
1120582102 14:86265214-86265236 CTATGTGTGAGCACGTGAGATGG + Intergenic
1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG + Intronic
1121062290 14:90924051-90924073 CTTTGGGGGAGGAGTTGATAGGG + Intronic
1121691938 14:95884283-95884305 TGGTGGGAGAGGAGGTGAGATGG - Intergenic
1122424392 14:101597270-101597292 CTCTGGGGGAGAGGGTGGGAAGG - Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122726553 14:103758628-103758650 CTCTGGGTGAGGAGCTATGGGGG + Intronic
1122746383 14:103899484-103899506 CTCCGGGTGGGGTGGGGAGATGG + Intergenic
1124493333 15:30171762-30171784 CTCTGGAGAAGGAGGTGGGAAGG - Intergenic
1124750201 15:32366563-32366585 CTCTGGAGAAGGAGGTGGGAAGG + Intergenic
1124846954 15:33300612-33300634 CACTGGCTGAGGTGGTCAGAAGG - Intergenic
1125884892 15:43221118-43221140 CCCTGGGGGAGGGGGTGGGATGG + Exonic
1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG + Intergenic
1128231391 15:66037863-66037885 CTCTGGAAGAGGAGGTGATCGGG + Intronic
1128714784 15:69900319-69900341 CTCTTGGTGAGCTGGTGAGTGGG + Intergenic
1130098950 15:80877434-80877456 TTGGGGGTGAGGAGGTGGGAAGG - Intronic
1130392733 15:83473290-83473312 CCAGGGGTGAGGAGGGGAGAGGG + Intronic
1130937967 15:88486147-88486169 CTATGGGTGATGAGGGGTGATGG + Intergenic
1132162318 15:99554332-99554354 CTGTGGGTGAGGTGGGGAGTGGG - Intergenic
1132352904 15:101150883-101150905 CTCTGGGTGAGGGGGTGCTTGGG + Intergenic
1132354203 15:101159306-101159328 CTCTTGGTGGGGTGGTGAGTGGG - Intergenic
1132839203 16:1970485-1970507 CTCTGGAGGCTGAGGTGAGAGGG - Intergenic
1133140628 16:3741151-3741173 CCCTGGGTGAGGAGGGGTGGCGG - Intronic
1133368693 16:5231578-5231600 CTCTGGTGGAGGTGGTGGGAAGG - Intergenic
1134070249 16:11256046-11256068 CCCTGGGCGAGGAGGCGGGAGGG - Intronic
1134073275 16:11273614-11273636 CTCTGGGCAAGGAGGTGAGGCGG + Intronic
1134121094 16:11585977-11585999 GTCAGGGAGAGGAGGTGATAGGG - Intronic
1134188821 16:12105714-12105736 TTCTGGGGCAGGAGGAGAGAAGG - Intronic
1135772713 16:25229322-25229344 CTCTAGGTGGGGAGGTGGGGGGG + Intergenic
1136284514 16:29233265-29233287 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1136299145 16:29321430-29321452 CTCCGGGTGAGGAAGTGGGGTGG + Intergenic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1137539911 16:49355206-49355228 CGCTGGGCGAGGAAGTGACAAGG + Intergenic
1137692767 16:50441026-50441048 CCCTGAGTGAGGAGGAGAGAGGG - Intergenic
1138483239 16:57318167-57318189 CACTGAGTGAGGTTGTGAGAAGG - Intergenic
1138534075 16:57650567-57650589 CTCTGGCTGCAGAGGTGAGTGGG - Intronic
1139153173 16:64409184-64409206 CCCTGGGTGAGGGAGTGAGGTGG - Intergenic
1139526152 16:67518118-67518140 CTCGGGCTGGGGAAGTGAGAGGG + Intergenic
1139545724 16:67648664-67648686 CTCTGGGAGAGGACGTTACACGG - Exonic
1139665650 16:68453703-68453725 CTCAGTGTGAGGAGGTGTGGTGG + Intergenic
1139683466 16:68583299-68583321 CTCGGGGAGAGGAGGAGTGACGG - Intergenic
1140473472 16:75227293-75227315 CTCTGGGAGAGGAGGTGAGTGGG + Intergenic
1141472195 16:84246642-84246664 GCTTGGGAGAGGAGGTGAGAGGG + Intergenic
1142089549 16:88202778-88202800 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1142178668 16:88656732-88656754 CCCTGTGGGAGGAGGGGAGAAGG - Intronic
1142324029 16:89402675-89402697 TTCTGCGGGAGGAGGTGAGGTGG + Intronic
1142324056 16:89402776-89402798 CTCTGTGGGATGAGGTGAGGTGG + Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143273029 17:5689562-5689584 CTCCAGGTGAGGAGATGACATGG + Intergenic
1144296989 17:13885676-13885698 CGATGGGTCAGGGGGTGAGATGG - Intergenic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145898083 17:28472277-28472299 GTCAGGGTGAGGAGGGGTGAGGG + Intronic
1146549507 17:33768473-33768495 CTCAAGCTGAGGAGGTGTGATGG + Intronic
1147159712 17:38562919-38562941 CCCTGGGAGAGGCGGGGAGACGG + Exonic
1147644875 17:42027568-42027590 GACTGGGTCAGGAGGGGAGAGGG - Intronic
1147868546 17:43570865-43570887 CTCTGGCATAGGAGGTGGGATGG - Intronic
1147932283 17:43989471-43989493 CTCTGGGTGGGAATGTGAAATGG - Intronic
1148110725 17:45143681-45143703 CTTTAGGGGAGGAGGTGCGAAGG - Exonic
1148144713 17:45355875-45355897 CTCAGAGCCAGGAGGTGAGAGGG - Intergenic
1148204607 17:45772006-45772028 GTCCAGGTGAGGAGTTGAGATGG + Intergenic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148443673 17:47725239-47725261 CCCTAGGTGAGAAGGTAAGAAGG + Intergenic
1148698583 17:49575509-49575531 CTCTTGGAGAGGAAGGGAGAGGG - Intergenic
1148822514 17:50367754-50367776 ATCTGAGTGAGGAAATGAGAAGG - Intergenic
1148856951 17:50584096-50584118 GTTTGGGAGAGGAGGCGAGAGGG + Intronic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1150432433 17:65129169-65129191 CTCTTTGTAAGGAGCTGAGAGGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1152018054 17:77764984-77765006 CTCTAGGTGAGGAAGTAAGTGGG - Intergenic
1152259521 17:79259559-79259581 CTCTGGGGGCCCAGGTGAGATGG + Intronic
1152286475 17:79415913-79415935 CTGCAGGTGAGGAGGTGGGAGGG - Intronic
1153168001 18:2283898-2283920 CTTTGGGCGAGGAAGGGAGAAGG - Intergenic
1153356650 18:4144006-4144028 CTCTGCTTGAGGAGAGGAGAAGG - Intronic
1153454301 18:5262793-5262815 CTCTTGCTGAAGAGGTGATATGG - Intergenic
1153933591 18:9900901-9900923 TGCTGGGTGTGGAGATGAGATGG + Intergenic
1155358448 18:24977107-24977129 CTTTCTGAGAGGAGGTGAGAGGG - Intergenic
1155680049 18:28477021-28477043 GACTGGGTGAAGAGGTGACAAGG - Intergenic
1155888994 18:31243187-31243209 CAATGGGTGAGGGGGTGGGAAGG + Intergenic
1156435427 18:37122714-37122736 CTGTGAATCAGGAGGTGAGATGG + Intronic
1156500414 18:37554061-37554083 TTGTGGCTGAGGAGGGGAGAGGG + Intronic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1157337525 18:46752551-46752573 CCCTTGGTCAGGAGGGGAGAAGG - Intronic
1157752587 18:50193272-50193294 CTCTGGGGGAGGAGGGGAGGAGG - Intronic
1158468443 18:57712740-57712762 TTCTGCTTGAGGAGATGAGAGGG + Intronic
1160381825 18:78463512-78463534 ATGTTGGTGAGGAGGTGAAATGG - Intergenic
1160545594 18:79651141-79651163 GTCTGGGCCAGGAGGTGAGCTGG + Intergenic
1161904728 19:7148279-7148301 CCCTGGGTGATGGGGTCAGAAGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162317009 19:9945654-9945676 CTCTGGGGGAGGAGGAGGGAAGG + Intergenic
1162568768 19:11458610-11458632 ACCTGGGTGAGGGGGTCAGATGG + Exonic
1162824436 19:13243064-13243086 CTTTGGGTCAAGAGGTTAGAAGG - Intronic
1162968866 19:14168241-14168263 CCCTGGGTGAGGCGCTGGGAAGG - Intronic
1163216795 19:15885138-15885160 CTTTGGGGGAGGAAGAGAGAGGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163450334 19:17373345-17373367 CTCTGGGCGAGGGGTTGAGGTGG + Intronic
1164676867 19:30106922-30106944 GGCTGGGTGAGTGGGTGAGAGGG + Intergenic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1165799958 19:38543430-38543452 CTGCAGGTGAGGACGTGAGACGG + Exonic
1165899421 19:39161876-39161898 ACCTGCGTGAGGAGGGGAGAGGG - Intronic
1165984491 19:39756100-39756122 CTCTGAGTGAGGAGGTCACCCGG + Intergenic
1166552591 19:43676356-43676378 CTCTGGTTGGGGAGGTGGGGGGG + Intergenic
1166752212 19:45169740-45169762 CGCTGTGGGAGGAGGTGACACGG - Intronic
1167601913 19:50459487-50459509 GGGTGGGAGAGGAGGTGAGATGG + Intronic
1168147861 19:54429779-54429801 CCCTGGGTGGGGAGGGGAGCTGG + Intronic
1168602118 19:57726552-57726574 CTCTGGGGTAAGAGATGAGAAGG - Intronic
924970164 2:118862-118884 ATCTGGGTGATGAGGTGATGAGG + Intergenic
925512215 2:4640815-4640837 CTTTGGGTGAGGAGTTGGTAGGG - Intergenic
925705438 2:6680558-6680580 CTCTGTGTGAGGTGGTAAGGAGG + Intergenic
925904502 2:8531605-8531627 TTCTGTGTGAGGAGATGGGAAGG + Intergenic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926648127 2:15312232-15312254 CTCTAGGTGAGGATGTAAGGTGG - Intronic
927250474 2:20991471-20991493 GCCTGGGTGAGCAGGTGAGAAGG - Intergenic
928021175 2:27706270-27706292 CTGAGGGTGGGGAGGTGGGAGGG + Exonic
928116049 2:28545834-28545856 CTCTGTGTGGGGAGCAGAGAGGG + Intronic
928231832 2:29505180-29505202 CTCTGGGTTCTCAGGTGAGAAGG + Intronic
928265271 2:29805990-29806012 ATGTGAGTGAGGAGGTGAAATGG + Intronic
928451996 2:31385837-31385859 TTCTGGGGGAGGATGTGATAAGG - Intronic
928730164 2:34222687-34222709 TTCTAAGTGAGGAGGTGAGGTGG + Intergenic
928904461 2:36355693-36355715 GTCTGGGGGAGGAGGTAGGATGG + Intergenic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929099936 2:38301931-38301953 TTCTGCGTGAGGAGAGGAGAGGG + Intronic
929122329 2:38493889-38493911 ATCTGGGATAGGAGGGGAGAGGG + Intergenic
929302688 2:40324255-40324277 CTCTAAGTGAGAAGGTAAGAAGG + Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
931012226 2:57929962-57929984 CTCTGCTTGAGGAGAGGAGAGGG - Intronic
931198484 2:60075039-60075061 CTGGGGATGGGGAGGTGAGATGG - Intergenic
931259214 2:60602407-60602429 CACTAGGTTCGGAGGTGAGAAGG - Intergenic
932230731 2:70082230-70082252 CTGTGGATGAGGTGGTGAGGCGG - Intergenic
932558135 2:72843484-72843506 ACCTGGGAGAGGTGGTGAGATGG - Intergenic
933215607 2:79626370-79626392 CACTGGGTGGGGAAGTGAGAGGG + Intronic
934591309 2:95552468-95552490 CTCTGGAAGCTGAGGTGAGAGGG - Intergenic
934689556 2:96347838-96347860 CTCTGAGTGGTGAGGTGAGCAGG + Intronic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
935363734 2:102268619-102268641 CTCAGGGTGAGGATGGGAGGAGG - Intergenic
935832171 2:107011598-107011620 CTCTGGTTGTGGTGGTGATATGG + Intergenic
936290631 2:111221073-111221095 ATTTGGGTGTGGGGGTGAGAGGG - Intergenic
937009605 2:118550807-118550829 CTGAGGGTGAGAGGGTGAGAGGG - Intergenic
937027979 2:118714918-118714940 GTGGGGGTGAGGGGGTGAGAGGG + Intergenic
937309980 2:120896224-120896246 CTCAGGGTGGGGCGGAGAGAGGG - Intronic
937362555 2:121239169-121239191 CACTGAGTGTGGGGGTGAGAGGG - Intronic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937854210 2:126660870-126660892 AGCTGGGTGAGAAGGTGGGAAGG - Intronic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938197928 2:129347719-129347741 CTCTTGGTTATGAGGTGAGCTGG - Intergenic
938528693 2:132162137-132162159 CTCAGGTTGAGGAGGGGACAGGG - Intronic
938734186 2:134171545-134171567 CTCTGGGTGTCGAAGTGATAGGG + Intronic
939120060 2:138105602-138105624 TTCTGGGTGATAAGATGAGAAGG - Intergenic
940330965 2:152474209-152474231 CACTGGGTAAGCAAGTGAGATGG - Intronic
940404375 2:153283929-153283951 GCCTGGGTGTGGAGCTGAGAGGG + Intergenic
941439132 2:165511655-165511677 CTGAGAGTGAGGAGGTGGGAAGG + Intronic
942538973 2:176995659-176995681 CTCTAAGTGTGGAGGAGAGAAGG - Intergenic
944027417 2:195187969-195187991 CTCTTGCTGATGAGGTGGGAAGG - Intergenic
945215819 2:207433004-207433026 CGCTTGGTGAGGTGGTGACATGG - Intergenic
945292425 2:208139098-208139120 CTCTGGGTGAGTCAGTGAGGAGG + Intergenic
945906079 2:215594947-215594969 CTCTGGGTGAGTCAGTGAGTGGG - Intergenic
945932299 2:215867084-215867106 CTGTGGCAGAAGAGGTGAGAGGG - Intergenic
945934848 2:215892749-215892771 ATCTGGGAAAAGAGGTGAGAAGG + Intergenic
947444935 2:230156392-230156414 GTCCAGGTGAGGAGGGGAGATGG - Intergenic
947809015 2:232988184-232988206 CACTGGGGGAGGAGGGGAGGTGG + Intronic
947860937 2:233356648-233356670 TTCTGGTTGAGGAGGAGTGATGG + Intronic
947926384 2:233925831-233925853 CTTTGGGAGACGAGGGGAGAGGG + Intronic
947964205 2:234265714-234265736 CTCTGGGGGAGGTGGTGTGAAGG - Intergenic
948548179 2:238747117-238747139 CACTGAGTCAGGAGCTGAGAGGG + Intergenic
948799190 2:240423564-240423586 CTCTGGGTGAGGGTGTGAATGGG + Intergenic
948809425 2:240467152-240467174 ATCTGGGTGAGGATGGGAGCAGG - Exonic
1168951343 20:1803923-1803945 CCCTTGGTGATGCGGTGAGAGGG - Intergenic
1168974702 20:1955582-1955604 CTCTGGGGGAGGTGGCGGGAAGG - Intergenic
1169057956 20:2639295-2639317 CTCTGGGTGAGTCAGTGAGTGGG - Intronic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1170709311 20:18775736-18775758 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
1171364968 20:24617339-24617361 AGCTGGGTGCGGAGGTGACAGGG - Intronic
1171422249 20:25025051-25025073 CTATGGGCGAGGAAGGGAGATGG + Intronic
1171996006 20:31731928-31731950 CTCTGGATGCTGAGATGAGAGGG - Intergenic
1172007612 20:31828256-31828278 CTCTGGGTGTGGAGCAGGGAAGG + Intronic
1172418885 20:34797222-34797244 CTCTGCTTGAGGAGAGGAGAGGG + Intronic
1172485247 20:35293992-35294014 CTCTGGGGAAGGGGGTGAGCAGG + Intergenic
1172952936 20:38733616-38733638 CTCAGGGAGATGAGGAGAGATGG - Intergenic
1173644600 20:44625683-44625705 CTCTGTGTGAGGAGAGGAGTAGG + Exonic
1174116907 20:48232479-48232501 CTTTTAGTGAGGAGGTGACATGG - Intergenic
1174413940 20:50354808-50354830 TTCTGGCTGAGCAGGAGAGAGGG - Intergenic
1174698707 20:52586159-52586181 CTCTGGAGGCTGAGGTGAGAGGG - Intergenic
1174730259 20:52909198-52909220 CTCTGGAGGATGAGGTGGGAAGG + Intergenic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175010514 20:55729830-55729852 TTGTGGGTGAGGAGGAGACAAGG + Intergenic
1175337959 20:58208553-58208575 TTCTGGGTGAGTAAGTGAGAGGG - Intergenic
1175436638 20:58956535-58956557 CTCTGGCTGAGTCAGTGAGAGGG + Intergenic
1175563677 20:59954985-59955007 TCCTGGCTGGGGAGGTGAGAAGG - Intergenic
1175923752 20:62462173-62462195 CCCTGGGTGAGGGGGTGAGGGGG - Intergenic
1176053044 20:63130701-63130723 CTCTCGGGGAGGGGGTGTGAGGG - Intergenic
1176123629 20:63465393-63465415 TCCTGGGTGAGGGGGTGTGAGGG - Intronic
1177276023 21:18913791-18913813 CTCTGGATGAGGAGAGAAGAGGG - Intergenic
1177571132 21:22888478-22888500 CTCTGGGGAAGGTGGTGGGAGGG + Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1178430263 21:32512561-32512583 CACTGGGAGAGGAGGGGAGGGGG + Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179452018 21:41474040-41474062 GGGTGAGTGAGGAGGTGAGAGGG + Intronic
1179452133 21:41474389-41474411 GGGTGGGTGAGGAGGTGAGGGGG + Intronic
1179452161 21:41474469-41474491 GGGTGGGTGAGGAGGTGAGGGGG + Intronic
1179551010 21:42143995-42144017 CTCTGGGCGAAGTGATGAGAGGG + Intergenic
1180000605 21:44993734-44993756 CTCGTGGTGAGCAGGTGGGAAGG - Intergenic
1180029809 21:45199316-45199338 CTCTGGATGATGAGCTGAGCTGG - Intronic
1180670572 22:17549393-17549415 CCCTGGGTGGTGAGGTGGGAGGG - Exonic
1180998550 22:19977361-19977383 CGCTGGGGCAGGAGTTGAGATGG + Intronic
1181428049 22:22856607-22856629 CCCTGAGTGAGGAGGTGAGGAGG - Intronic
1181630664 22:24149499-24149521 CAGTGGGGGAGAAGGTGAGATGG + Intronic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182517120 22:30865198-30865220 CTCTGGCTGAGGAGGCCACAGGG - Intronic
1182787226 22:32917932-32917954 CCCTGGGTGAAGAGATTAGATGG + Intronic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183366863 22:37411448-37411470 CCCTGGGTGAGGAGGGGAAGCGG + Intronic
1183459598 22:37941808-37941830 CTATGGGAGAGGAGGAGTGATGG + Exonic
1183489484 22:38108977-38108999 CTCTGGCTGCAGAGGTGTGAGGG + Intronic
1183712032 22:39510619-39510641 CTCTGTGTGAGGTGATGTGATGG + Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1183783542 22:40015572-40015594 CACTGGCTGAGGAGGGGAGTGGG - Intronic
1184103574 22:42354389-42354411 AAGCGGGTGAGGAGGTGAGAAGG - Intergenic
1184187321 22:42873472-42873494 CTCTGGGTGCTGAGGGGAGGAGG + Intronic
1184313765 22:43666220-43666242 TTCTGGCTGGGGAGGGGAGAGGG + Intronic
1184735967 22:46398033-46398055 GGCTGGGTGAGGAGCTCAGAGGG + Intronic
950500442 3:13360261-13360283 CCTTGGGTGAGCAGGTGAGTGGG - Exonic
950520156 3:13493315-13493337 CCCTGGGTGAGGGGAGGAGAGGG - Intronic
950655381 3:14433196-14433218 CTCTGGGGGAGGTGGCGGGAGGG - Intronic
950709638 3:14805121-14805143 GTCTGGGGGAGGGGGTGACATGG - Intergenic
950825059 3:15809964-15809986 TTGTGGATGAGGAGGTGGGAGGG - Intronic
951829335 3:26906996-26907018 CTCTGCGTGTGGTTGTGAGAGGG - Intergenic
952002646 3:28804319-28804341 TTCAGGGTGAGTAGGGGAGAAGG - Intergenic
952049700 3:29369539-29369561 GTGAGGGTGAGGAGGAGAGAGGG + Intronic
953031065 3:39180351-39180373 ATGTGGGTGAGGAGGAGAGTGGG + Intergenic
953116069 3:39993616-39993638 CTGAGAGTGAGGAGGTGACAAGG - Intronic
953261164 3:41340333-41340355 CTCTAGGAGAGAAGGTGGGAAGG + Intronic
953330381 3:42048059-42048081 CTCTTGGAGTGGAGGAGAGAGGG - Intronic
953877442 3:46674292-46674314 CTCTGGGAGAGGAGCTGGGAGGG + Intronic
954626463 3:52024540-52024562 CTCTTGGTGAGGGGAAGAGAGGG + Intergenic
954661638 3:52229823-52229845 CTCTGGGTGCGAAGGTCAGCAGG - Intronic
954662458 3:52233309-52233331 TTCTGGGTGGGCAGGTGAGGAGG - Intronic
954744270 3:52778159-52778181 CTGTGGGATATGAGGTGAGATGG - Intronic
954904497 3:54048613-54048635 CTCTGGATGAAGTGGTCAGAGGG - Intergenic
955002088 3:54937008-54937030 CTGTGTGTGAGGAGGTGCTAAGG + Intronic
955078064 3:55632448-55632470 CTCTGGGAAACCAGGTGAGATGG + Intronic
957021103 3:75127503-75127525 CTCTGGGTGAGTCAGTGAGTAGG - Intergenic
958833027 3:99112546-99112568 CTGTGTGTCAGGGGGTGAGAGGG + Intergenic
958862236 3:99457985-99458007 CTGTGGGTGAGGAGGTTTGCAGG + Intergenic
960411572 3:117333297-117333319 CTCTTGGTGTGGTGGTGAGGTGG + Intergenic
960513201 3:118575218-118575240 TTCTCAGTGAGAAGGTGAGATGG + Intergenic
960881581 3:122351007-122351029 CTCTGGGTGAGTCAGTGAGTGGG - Intergenic
961243473 3:125432231-125432253 CTGTGGGCAAGGAGGTGTGAGGG - Intergenic
961557619 3:127707344-127707366 CGCTGTGGGAGGAGGTGAGGAGG - Intronic
962208474 3:133455736-133455758 GCCTGGCAGAGGAGGTGAGATGG - Intronic
962406787 3:135107314-135107336 CTCTGGATAGGGATGTGAGAAGG + Intronic
962580265 3:136791618-136791640 CTCTGGGTAAGTGGGTGAAAGGG + Intergenic
962581215 3:136799601-136799623 CTCTGGGAGAGTTGGTGTGAAGG - Intergenic
962633292 3:137301762-137301784 CTCTGGATGTGGAAGTTAGAGGG + Intergenic
963216175 3:142751222-142751244 CCCTGGGTGAGGTAGTGAGTGGG - Intronic
963793086 3:149604370-149604392 CTCTGGATGATGAGTAGAGATGG - Intronic
964641089 3:158911207-158911229 CTTTGGGTCAGCAGGTGGGATGG + Intergenic
965145045 3:164890263-164890285 CTCTGCTTGAGGAGAGGAGATGG - Intergenic
965614615 3:170581283-170581305 CTCAGTGTGAGGGGGTGAGAGGG - Intronic
965815894 3:172636476-172636498 CTCTGGGTTACGAGGTGACTTGG + Intronic
965868113 3:173230763-173230785 CTCTGGGTGAGTCAGTGAGTGGG + Intergenic
966293384 3:178387268-178387290 CTCTGGGGGAGGATGTGAGTAGG - Intergenic
966751059 3:183322778-183322800 CTATAGGTGAGAAGGTGGGAGGG - Intronic
966882243 3:184357165-184357187 CATTGGGTGAGGAGCTGAGGGGG - Exonic
968088820 3:195886944-195886966 AGGTGGGTGAGGAGGTGGGAGGG - Intronic
968938688 4:3626723-3626745 TTCTGGGTGAGGCGGTGGGGAGG - Intergenic
968945373 4:3660922-3660944 CACTGTGGCAGGAGGTGAGAGGG + Intergenic
968948487 4:3678050-3678072 CTGAGGGTGAGGAGGAGAGGAGG + Intergenic
969370157 4:6726929-6726951 TCCTGGGGGAGGAGGAGAGAAGG + Intergenic
969514376 4:7638333-7638355 CACTGAGTGAGGAGCTGACAAGG - Exonic
970676735 4:18459061-18459083 CCCAGGCTGAGCAGGTGAGAGGG + Intergenic
971616975 4:28803632-28803654 CTCTGGGGGAGGTGGCGGGAAGG - Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
973136157 4:46709160-46709182 CTCTCAGTGGGGAGGTGAGCTGG - Intergenic
973808492 4:54548009-54548031 CTCTGAGTCAGCAGGTAAGAAGG - Intergenic
974469601 4:62302012-62302034 TTCTGCTTGAGGAGATGAGAGGG + Intergenic
974890354 4:67874579-67874601 ATGGGAGTGAGGAGGTGAGAAGG + Intronic
975119691 4:70715156-70715178 TTCTGGGAAAGGAGGTGGGAGGG + Intronic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
975880001 4:78893805-78893827 CTCTGGAGGTTGAGGTGAGAGGG - Intronic
977307407 4:95342258-95342280 CTCTGCTTGAGGAGAGGAGAGGG + Intronic
979227191 4:118300116-118300138 CTTGGGGGGATGAGGTGAGAGGG - Intronic
979315472 4:119256346-119256368 CTCTGTATGAACAGGTGAGATGG + Exonic
981017461 4:139988841-139988863 CACTGGCTGAGGAAGTGAGAAGG + Intronic
982804551 4:159748102-159748124 GTCTGGGTCAGCAGGTGAGTGGG + Intergenic
983147896 4:164241146-164241168 TTCTGGGTGAGGGGGTCACAGGG - Intronic
983421785 4:167527349-167527371 TTCTGCTTGAGGAGGAGAGAAGG - Intergenic
985035713 4:185838302-185838324 CACAGCGTGAGGAGATGAGATGG - Intronic
985250891 4:188023367-188023389 AGCTGGGTGAGGAGGGGGGATGG + Intergenic
985565587 5:613959-613981 CTCTGAGGAAGCAGGTGAGAGGG + Intronic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
985903449 5:2814591-2814613 CTCTGAGGGAGGAGGAGTGAAGG + Intergenic
986309776 5:6543472-6543494 ATAAGGGTGAGTAGGTGAGATGG - Intergenic
987016184 5:13822356-13822378 CTCTGGATGCTGAGGTGGGAGGG - Intronic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
987183017 5:15386248-15386270 CTCTGGGGAAGGAGGAGGGATGG - Intergenic
987484481 5:18507301-18507323 CTCTGGGTGAGTCAGTGAGTTGG + Intergenic
987496585 5:18652937-18652959 CTTTGGGTGAGAATCTGAGATGG - Intergenic
987519869 5:18967829-18967851 CTCTGGGTGAGTCAGTGAGTGGG + Intergenic
987901853 5:24023101-24023123 CTATGGGGGAGGAGGTGAATGGG + Intronic
989671765 5:43925390-43925412 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
990318302 5:54605046-54605068 CTCTGGTGGAGGAAGTGTGAGGG + Intergenic
990555791 5:56934528-56934550 ATTTGGGTGGTGAGGTGAGAAGG + Intronic
990852695 5:60224847-60224869 ATCTGGGGGAGGCGGGGAGAGGG + Intronic
991514355 5:67417203-67417225 CACTGGGTCAGGAAGTGAGGGGG + Intergenic
991919581 5:71642304-71642326 TAAAGGGTGAGGAGGTGAGAGGG + Intronic
992567229 5:78010031-78010053 CTATGGGTGAAAATGTGAGATGG + Intronic
993588186 5:89759095-89759117 ATTTGGATGAGGAGGTGGGAAGG - Intergenic
993779691 5:92051059-92051081 CTCTGCATGAGGAGGAGAGGTGG + Intergenic
994109368 5:95983215-95983237 CTCTGAGAGAGAGGGTGAGAGGG + Intergenic
994211734 5:97094789-97094811 CACTGGGTGAGGAAGTGTCAGGG + Exonic
997202786 5:132022814-132022836 CTCTGGGAATGGAGGTGAGGGGG + Intergenic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
997266444 5:132497690-132497712 CTGTGGGGGAGCAGGTCAGAAGG - Intergenic
997715036 5:136036214-136036236 GTCTGGATGAGGTGGGGAGATGG + Intronic
997994841 5:138577133-138577155 CCCTGGGTGAGGAACTGTGAAGG + Intergenic
998133481 5:139662661-139662683 CCGTGGTTGAGGAGGAGAGAGGG + Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
999631502 5:153576363-153576385 CACTGGGAGAAGAGATGAGAAGG + Intronic
1000145581 5:158450108-158450130 GTATGTGTGAGGAGCTGAGAGGG + Intergenic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1001104899 5:168844502-168844524 GTCTGTGTGGGGAGGAGAGAGGG - Intronic
1002067784 5:176660874-176660896 CTCTGGGTGAGGTGGTCATATGG + Intergenic
1002104930 5:176875351-176875373 CTCTGGGGGAGGGTGGGAGACGG - Intronic
1002292541 5:178209682-178209704 CTCTGGGGGAGGGGATGTGATGG + Intronic
1003278545 6:4673100-4673122 CTCAGGGAGAGGAGCTCAGAAGG + Intergenic
1003438009 6:6111803-6111825 CTCTGCTTGAGGAGAGGAGAAGG - Intergenic
1004524765 6:16396702-16396724 CTCTGGGTGAGTCAGTGAGTGGG - Intronic
1004540849 6:16548300-16548322 CTCTGGGTGAGTCAGTGAGTGGG + Intronic
1004549092 6:16629326-16629348 CTCAGGGGGAGGCGGGGAGAAGG - Intronic
1004755407 6:18605329-18605351 CATTGGCTGAGGAGGTGGGATGG - Intergenic
1004898764 6:20174548-20174570 CTCTGAGTGAGTCAGTGAGAGGG + Intronic
1004948794 6:20645148-20645170 CTCTGGGTGAGTCAGTGAGTGGG + Intronic
1005145494 6:22685252-22685274 CTCTGTATGAGGAGATAAGATGG - Intergenic
1005194591 6:23268338-23268360 TTATTGGTGAAGAGGTGAGATGG - Intergenic
1005605774 6:27475669-27475691 AACTGGGGGAGGAGGGGAGAAGG + Intergenic
1005633255 6:27728959-27728981 CTCTAGGTGAGAGAGTGAGAAGG - Intergenic
1005740415 6:28785885-28785907 GTCCAGGTGAGGAGGTGAGAAGG + Intergenic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1005882207 6:30070418-30070440 CCCAGGTTGAGGAGGAGAGAGGG + Exonic
1006034834 6:31202941-31202963 CTCTCGGTGAGGTTGGGAGAAGG + Exonic
1006112664 6:31758102-31758124 CTCGGGTTGAGGTGGTGATAGGG - Intronic
1006395458 6:33784184-33784206 GCCTGAGTGAGGAGGCGAGAAGG + Intronic
1006642192 6:35495275-35495297 CTTTGGGTGAGGATGGGAGCAGG + Intronic
1006679686 6:35788045-35788067 CTCTGGGTAGGGAGGAGAGCAGG - Exonic
1007717430 6:43865315-43865337 CTGTGGGTGCGGAGATGGGAAGG + Intergenic
1007910369 6:45507205-45507227 CTCTGGGTGAGGCAGGGTGACGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008930728 6:56936500-56936522 TTCTGGGTAGCGAGGTGAGAAGG + Intronic
1010552746 6:77243088-77243110 CTCCGGGTGTTGAAGTGAGAGGG + Intergenic
1010807049 6:80249650-80249672 CTCTTGGGGTGGAGGTAAGAGGG + Intronic
1011271030 6:85580086-85580108 CTCTGCTTGAGGAGAGGAGAGGG + Intronic
1011303509 6:85901404-85901426 CTCTGGTTGAGAAGGTGGGCTGG + Intergenic
1012047773 6:94300760-94300782 CTGTGCGTGAGGAGAAGAGAGGG + Intergenic
1012237899 6:96838606-96838628 CTCTGTCTGAGGAGGTGGGCAGG + Intergenic
1012758349 6:103263126-103263148 CACTGGGTTAGGAAGTCAGAAGG + Intergenic
1013042077 6:106445309-106445331 CTCTGAGTGAGGAGTTGGGTGGG + Intergenic
1013917837 6:115363587-115363609 CTATGGGAAAGGAAGTGAGATGG - Intergenic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1015602944 6:134928197-134928219 GTCAGGGTGAGGAGGGGAAAAGG - Intronic
1016731793 6:147435487-147435509 CTTTGGGAAAGGAGGTGAGGAGG - Intergenic
1016758834 6:147715865-147715887 CTCCAGGAGAGGAGGAGAGATGG - Intronic
1017970132 6:159304805-159304827 GTCTGGCTGAGGAGGGGTGAGGG + Intergenic
1019131954 6:169883370-169883392 CTCTGGGTTATGAGGGGATAAGG + Intergenic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019598457 7:1869281-1869303 CTCTGGGAGAGGCTGTGGGAGGG - Intronic
1020092891 7:5351180-5351202 TTCTGGGTGGGGAGGAGGGAGGG + Intronic
1020929500 7:14375104-14375126 CTCTGTGGGAGGCGGAGAGAGGG - Intronic
1021961512 7:25877805-25877827 CTCTCGGTGAGGAGAGAAGAGGG + Intergenic
1022617299 7:31944427-31944449 CTGAGGGTGGGCAGGTGAGAGGG + Intronic
1023392951 7:39728118-39728140 CTCAGGGAGACGAGGTGGGAAGG - Intergenic
1024118274 7:46213038-46213060 CTCCCAGTGGGGAGGTGAGAAGG + Intergenic
1024122405 7:46257904-46257926 GGCGGGCTGAGGAGGTGAGATGG - Intergenic
1024616936 7:51123820-51123842 ATGTGGGTGAGGAGGTGGCATGG - Intronic
1024754406 7:52512733-52512755 CTGTGGGTGATGTGATGAGAGGG - Intergenic
1026214912 7:68339959-68339981 CTTTGGGAGAGGGAGTGAGAAGG - Intergenic
1026851662 7:73727717-73727739 CTCTGGAGGCTGAGGTGAGAGGG - Intergenic
1026962792 7:74419764-74419786 CTCTGGGAGAGCAGTTGAGGTGG - Intergenic
1027146680 7:75700413-75700435 TTCTGGGTGAGCAGGTTAGCTGG - Intronic
1027430317 7:78104979-78105001 TTCTGGGAGATGAGGTGGGAGGG - Intronic
1027455861 7:78390949-78390971 CTTTGGGTGAGGGTGGGAGATGG + Intronic
1028162298 7:87499184-87499206 TTCTGGGAGGTGAGGTGAGAAGG + Intergenic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1029431446 7:100533551-100533573 CACTGGGTGTGGTGGTGTGAGGG - Intergenic
1029745188 7:102512530-102512552 GACTGAGTGAGGGGGTGAGAGGG + Intronic
1029745260 7:102512780-102512802 GACTGAGTGAGGGGGTGAGAGGG + Intronic
1029763180 7:102611691-102611713 GACTGAGTGAGGGGGTGAGAGGG + Intronic
1030298090 7:107948669-107948691 TACTGGGTGAGGAGATGAGAAGG + Intronic
1030871789 7:114764790-114764812 CTCTGGAGGTGGAGGTGGGAGGG + Intergenic
1031183691 7:118448722-118448744 CTCTGGGAGAGGGAGAGAGATGG + Intergenic
1031454737 7:121965172-121965194 CTGTGGGTCAGGAGCTGAGGAGG + Intronic
1031652710 7:124310998-124311020 ATCTGGGTGAGTAGTTGAGAAGG + Intergenic
1032580237 7:133097217-133097239 CTCTGGGTCAGGAGCTGATGTGG + Intergenic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033369278 7:140694479-140694501 GGCTGGGCGAGTAGGTGAGATGG + Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033597405 7:142867318-142867340 CCCTGGGTGTGGATGTGGGAGGG + Intronic
1033927686 7:146483964-146483986 CTCTGGGTGAGTCAGTGAGTGGG - Intronic
1034845290 7:154438890-154438912 CTCTGGCTGAGGAGGAGAGGAGG + Intronic
1034847858 7:154463855-154463877 CTCTGCTTGAGGAGAGGAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034937138 7:155207494-155207516 CTCTGGGTGTGCAGGTGATTTGG + Intergenic
1034999934 7:155604399-155604421 CTCTGAGGATGGAGGTGAGAGGG + Intergenic
1035047706 7:155980171-155980193 CACTGGGTTAGGAAGTCAGAAGG + Intergenic
1035414380 7:158670551-158670573 CTTAGGGTGATGAGGTGAGGGGG - Intronic
1035473312 7:159125385-159125407 CCCTGGGTGAGGAGGACACAAGG + Intronic
1035673327 8:1436756-1436778 CTCTGGGTGACCGGGTGAGTGGG - Intergenic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1037076292 8:14723333-14723355 CTCTTGGGGAAGAGGTGAGTGGG + Intronic
1037919084 8:22791228-22791250 CTCGGGCTGAGGAGCAGAGAAGG + Intronic
1037921775 8:22811666-22811688 CTCTGGTTCAGGAGGTCACAGGG + Intronic
1038144075 8:24877735-24877757 CTTTGGGTGACGATGTGTGAAGG + Intergenic
1038446826 8:27610421-27610443 CACAGGGTGATGAGGTCAGAGGG - Intronic
1038643341 8:29344607-29344629 CCCTGTATGAGGATGTGAGAAGG - Intronic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1039041652 8:33414301-33414323 CTCTGGGGGAGGTGGTGGAAAGG - Intronic
1039195246 8:35023858-35023880 TTCAAGGTGAGAAGGTGAGAAGG - Intergenic
1039410069 8:37347070-37347092 CTCTGGGTGAGTCAGTGAGTGGG - Intergenic
1039469063 8:37802531-37802553 CCCTGGGTGGGGAGGGGAGTGGG - Intronic
1039606306 8:38883685-38883707 ATGTGGGTGAGTTGGTGAGAAGG + Intergenic
1039672728 8:39620860-39620882 GGATGGGTGAGGAGGTGAGAGGG + Intronic
1041852294 8:62405157-62405179 CTCTGCTTGAGGAGAGGAGAGGG - Intronic
1043338757 8:79210809-79210831 CTCTAAGTGAATAGGTGAGAAGG - Intergenic
1043822895 8:84890347-84890369 CTCTGGGGAATGAGGAGAGATGG + Intronic
1044429045 8:92087180-92087202 CTCAGGGTTGGGAGGTGGGATGG - Intronic
1044832383 8:96262307-96262329 CTCTGGGTGAGGAAGTGGGCTGG + Intronic
1045542230 8:103097657-103097679 CTAAGGGTGAGGGGGTGGGAGGG - Intergenic
1045976626 8:108137145-108137167 CTCTGGGAGGGAAGGTGAAATGG - Intergenic
1046742549 8:117844692-117844714 CTCTGTGTGAGTAGGTGTCATGG - Intronic
1047353022 8:124094172-124094194 CCCTAAGTGAGGTGGTGAGATGG - Intronic
1047701932 8:127457359-127457381 ATCTGAGTGAGAAAGTGAGAAGG - Intergenic
1047785197 8:128147371-128147393 GTCAGAGTGAGGAGGTAAGAGGG + Intergenic
1048425475 8:134319372-134319394 CTGAGGGTGAGGAATTGAGATGG - Intergenic
1049122096 8:140747972-140747994 TGCTGGGGGAGGAGGTGAAATGG + Intronic
1049123195 8:140758807-140758829 CTCTGGGTGAGTAAATGTGAAGG - Intronic
1049497864 8:142945114-142945136 CTCTGGGTGGGCAGGTGGGCAGG - Intergenic
1050151487 9:2622515-2622537 CTCTGGGGGAGGCGGAGTGAGGG - Intronic
1050226854 9:3468335-3468357 CTCTGGGTGAGGGGCACAGATGG - Intronic
1050979901 9:11996905-11996927 TACTGGGGGAGGGGGTGAGAGGG + Intergenic
1051207281 9:14701488-14701510 CTCTGGGAAAGGAGATGAAAAGG + Intergenic
1051473489 9:17476272-17476294 CTCAGGGAGAGGGAGTGAGATGG - Intronic
1051828075 9:21243690-21243712 ACCTGGGTCAGGAGGAGAGAAGG - Intergenic
1051837467 9:21357217-21357239 ATCTGGGTCAGGAGATGAGGGGG - Intergenic
1053312827 9:37030160-37030182 CTCTGGGTGCACAGGTAAGACGG - Intronic
1055461538 9:76524268-76524290 CACTGGGTAAGGAGGTTACAAGG + Intergenic
1056223379 9:84471514-84471536 CTCATGGGGAGGAGGGGAGAAGG - Intergenic
1056286298 9:85090997-85091019 ATCCTGGTGAGGAGGTGATATGG + Intergenic
1056722089 9:89081453-89081475 CTCAGGGTGTGGGGGTGGGAGGG - Intronic
1056961451 9:91127834-91127856 CTCTGGGTGAGTCAGTGAGTGGG - Intergenic
1057228617 9:93305449-93305471 CTCTGGGTGAGCAGCTCCGAAGG - Intronic
1057303439 9:93899474-93899496 CTCTGTATGAGGAGGGGAGCTGG - Intergenic
1057455668 9:95207635-95207657 CTCTGACTGAGCAGGTCAGACGG + Intronic
1057484903 9:95475343-95475365 CTCTGCATGGGAAGGTGAGAGGG + Intronic
1057740289 9:97705513-97705535 CTCTGGTGGAGGAAGTAAGAGGG - Intergenic
1057815337 9:98290096-98290118 CTCTGGGGGAGGAGGTGGGAAGG - Exonic
1058669336 9:107347449-107347471 CTCAAAGTGGGGAGGTGAGATGG + Intergenic
1059443606 9:114324749-114324771 CTCTGGGTGAGAACATGGGATGG - Intronic
1059444802 9:114331526-114331548 CTCTGGGTGAGAACATGGGATGG - Intronic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1060006357 9:120003539-120003561 CTCTGGATTAGGAAGTGGGAAGG - Intergenic
1060068816 9:120528935-120528957 CTTTGGGTGGGGTGGAGAGAGGG - Intronic
1060101778 9:120847057-120847079 CTCTGGGTGAGGAGAGAAGCAGG - Intergenic
1060184109 9:121553415-121553437 GTCTAGGCGAGGTGGTGAGAAGG - Intergenic
1060275287 9:122177881-122177903 CTCTGTGGGAGAAGGGGAGAGGG - Intronic
1060533798 9:124366653-124366675 CTCTGGGTGAGTCAGTGAGTGGG - Intronic
1060679256 9:125546782-125546804 CTCTGGGTTAGGAGCTGTGGCGG + Intronic
1060746194 9:126132884-126132906 CTCTGGGTGGGGATTTGAAAGGG - Intergenic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060920642 9:127418118-127418140 CTCTGGGGCAGGAGCTGGGATGG - Intergenic
1061277651 9:129578764-129578786 CTCTGGGGGAAGAGGGGATAAGG - Intergenic
1061515600 9:131088125-131088147 CACCGGGTGAGCAGGTGAGCAGG + Intronic
1061681078 9:132242660-132242682 GTCTGGGGGAGGAGGAGAGAAGG + Exonic
1061821465 9:133229163-133229185 CTCTGTGTGTGGAGCAGAGAGGG - Intergenic
1061833973 9:133317200-133317222 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1061994552 9:134177053-134177075 CACAGGGGGAGGAGGAGAGACGG - Intergenic
1062175186 9:135158004-135158026 CTCAGGGAGAGGTGGTGAGATGG + Intergenic
1062237781 9:135520901-135520923 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186900687 X:14052181-14052203 CTCTGAGTGAGGAGGAGTAAGGG + Intergenic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1188105708 X:26144801-26144823 TTCAGGTTGAGGAGGTGAGGAGG - Intergenic
1188161793 X:26814033-26814055 CTCTGCTTGAGGAAATGAGAGGG - Intergenic
1189050543 X:37640833-37640855 CTATGGCTGAAGAGGAGAGAAGG - Intronic
1189338759 X:40188004-40188026 CTCTGGAGGATGAGGTGGGAGGG - Intergenic
1189697455 X:43679388-43679410 CTCTAAGTGAGGGTGTGAGAAGG + Intronic
1190733761 X:53241752-53241774 CTGTGGGGGAGGAGATGGGAGGG - Intronic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1191908544 X:66122400-66122422 CTCTGGGGGTGGGGGTGAGGGGG + Intergenic
1191953487 X:66619494-66619516 CTTAGGTTGTGGAGGTGAGAGGG - Intronic
1192917305 X:75666337-75666359 CTCTGGGGGTGGAGCAGAGAGGG + Intergenic
1193143159 X:78050853-78050875 CTCAGGGTGAGGAGATAGGATGG + Intergenic
1193152625 X:78140402-78140424 CTGTGGGTGAGGGGCTGGGAAGG - Intergenic
1193326330 X:80182122-80182144 CTCTGGGTGAGCAGGCAGGATGG - Intergenic
1193981601 X:88187617-88187639 CTCTGCGTGAGGAGAGGAAATGG + Intergenic
1194440235 X:93923631-93923653 CTCTGGGTGAATAAGTGAGTGGG + Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1195447475 X:104970911-104970933 CTCTGGGTCAGTAGATGGGATGG + Intronic
1195939966 X:110159874-110159896 CTTAGGGTGAGGAGGTGAAAGGG + Intronic
1197782775 X:130173444-130173466 CTCTGAGTGACGTGGAGAGAAGG + Intronic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1198365050 X:135931807-135931829 CTCTGGGGGCTGAGGTGGGAAGG + Intergenic
1198382280 X:136095149-136095171 CTCTGGGTGAGTCAGTGAGTGGG + Intergenic
1198670457 X:139074737-139074759 CTGAGGCTGAGGAGTTGAGAAGG - Intronic
1198769355 X:140112502-140112524 CTCTGGGTGTGGAGTTGCAAAGG - Intergenic
1199185217 X:144908578-144908600 CACTAGGTAAGGAGGTGAGTTGG + Intergenic
1199708598 X:150451940-150451962 CTCTGGATGGGGACTTGAGAGGG - Intronic
1200068712 X:153517587-153517609 AGCTGGGTGAGGAGGAGGGAGGG - Intergenic
1200086904 X:153611454-153611476 GCCAGGGTGAGGGGGTGAGAGGG + Intergenic
1200208601 X:154335225-154335247 GTCTGCGTGAGCAGGTGAGAAGG - Intergenic
1201639360 Y:16162201-16162223 CTCTGGGTGAGTCTGTGAGTGGG - Intergenic
1201663453 Y:16423126-16423148 CTCTGGGTGAGTCTGTGAGTGGG + Intergenic