ID: 1148236585

View in Genome Browser
Species Human (GRCh38)
Location 17:45973230-45973252
Sequence CATGAGGCTAAGAACCTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148236585_1148236587 3 Left 1148236585 17:45973230-45973252 CCGCTGAGGTTCTTAGCCTCATG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1148236587 17:45973256-45973278 ATATCCAGATCAGATTCTCTTGG 0: 1
1: 0
2: 4
3: 16
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148236585 Original CRISPR CATGAGGCTAAGAACCTCAG CGG (reversed) Intronic
905745576 1:40414612-40414634 CATGGGGCTAAGAGCTTTAGAGG - Intronic
906902496 1:49850828-49850850 CATGAGGCTCAGAACATCAAGGG + Intronic
907273247 1:53303023-53303045 AATGGGGCTAACCACCTCAGAGG + Intronic
909064082 1:70911725-70911747 CATGAGACTGAAAAACTCAGAGG + Intronic
910770970 1:90832292-90832314 CATGAAGCTTAGAAACTGAGAGG - Intergenic
916370072 1:164082047-164082069 GCTGAGGCAAAGAACCTCAGAGG - Intergenic
918092037 1:181305437-181305459 AGTGAGGCTCAGAACCTAAGAGG - Intergenic
921466928 1:215499580-215499602 CATGAGGGTGAGACCCTAAGAGG + Intergenic
922324583 1:224516448-224516470 CACGAGACTATGAACCTTAGAGG + Intronic
923351810 1:233114827-233114849 CATGAGATTAAGAAACTCACAGG + Intronic
924191787 1:241561113-241561135 TATGAGGCTTGGAACCTTAGAGG - Intronic
1065327222 10:24559872-24559894 CATCAGGTTAAGAACCTCCAAGG - Intergenic
1068524967 10:58117880-58117902 GTTGAGGCTAAGAAGCTTAGGGG + Intergenic
1075912328 10:126135384-126135406 CATGAGGCTAAGATCCTGGGTGG + Intronic
1076782257 10:132730827-132730849 CATGAGGCTAACAAGCACCGAGG + Intronic
1077129980 11:966676-966698 CATGAGGCTCACACCCTCGGGGG - Intronic
1082090662 11:48086670-48086692 CCTGAGGCCAATGACCTCAGTGG - Intronic
1084025351 11:66444935-66444957 CATGAGGCCAAGAACCCACGTGG - Intronic
1084984638 11:72857836-72857858 CATGAAGCTGAGCCCCTCAGAGG - Intronic
1085614247 11:77983134-77983156 AATGGGGGTAATAACCTCAGAGG + Intronic
1090491186 11:127162332-127162354 CATTGAGCTAAGAACCCCAGGGG + Intergenic
1095758484 12:45799134-45799156 CATGAGGCTAACAGTCTCATGGG - Intronic
1095952099 12:47787185-47787207 CAGGTGGCGCAGAACCTCAGAGG - Intronic
1097324934 12:58265912-58265934 CATGAGGCTAACAATCTAATGGG + Intergenic
1098635103 12:72773937-72773959 TATGAGGTTAAGTACCTAAGAGG + Intergenic
1099248240 12:80219806-80219828 CATAAGGACAAGAACCTGAGGGG - Exonic
1101714373 12:107297620-107297642 CAGGAGGACAAGAACCTCATTGG + Intergenic
1102464874 12:113123408-113123430 CATTAGGCTGAGACCCTCAAGGG - Intronic
1104896691 12:132168328-132168350 ACTGAGGCTCAGGACCTCAGTGG - Intergenic
1107206649 13:37798540-37798562 CATGATACTAAAAACCTCATAGG + Intronic
1109793378 13:67278804-67278826 CTTGAGGTTAAGGGCCTCAGTGG - Intergenic
1109919190 13:69033452-69033474 CATGGGGCTTGGAACCTGAGTGG + Intergenic
1110507674 13:76307266-76307288 TCTGAGGCAAAGAACCTCTGAGG + Intergenic
1111349470 13:87007435-87007457 CATGAAACTAAGAACTTCACAGG - Intergenic
1113106131 13:106773384-106773406 AGTGAGGGTAAGAACTTCAGTGG - Intergenic
1114745688 14:25144042-25144064 CATAAGGCCAAGCACGTCAGTGG + Intergenic
1118153495 14:63214888-63214910 CATGACTCTAAGACCTTCAGAGG + Intronic
1118327243 14:64789894-64789916 CCTGAGGGAAAGAACCGCAGAGG + Intronic
1119168250 14:72513620-72513642 GATGAGGCCAAGAAACTGAGCGG - Intronic
1121679666 14:95782896-95782918 CATGAGGCTGTGGACATCAGCGG - Intergenic
1125172925 15:36786980-36787002 CATGAGGCCAAGAATGTAAGGGG - Intronic
1129440846 15:75579615-75579637 CGTGAGGCTCAGATCCTCGGAGG + Intergenic
1130413156 15:83664309-83664331 GAAGAGGCTCAGCACCTCAGAGG + Intronic
1131719311 15:95149961-95149983 CATATGGCTACCAACCTCAGAGG + Intergenic
1132729690 16:1355360-1355382 AATCAGGCTGAGAAACTCAGGGG + Intronic
1132860973 16:2071641-2071663 CATGAGGCTCAGGGCGTCAGAGG + Intronic
1140276533 16:73513799-73513821 CATGAGACAAAGAACCCCATAGG - Intergenic
1141418769 16:83898550-83898572 CATGACGCTCAGAGCCACAGAGG - Intergenic
1142475025 17:183556-183578 GAGGAGGCCAAGAGCCTCAGGGG + Intergenic
1143789956 17:9286919-9286941 CAAGAGGCAAAGACCCTGAGAGG - Intronic
1148236585 17:45973230-45973252 CATGAGGCTAAGAACCTCAGCGG - Intronic
1150894935 17:69198616-69198638 CATCAGGCTAAGGTCCTCAGTGG + Intronic
1151142497 17:72007340-72007362 CATGATGCTTAGAACATCACAGG - Intergenic
1155279280 18:24221403-24221425 AATGTGGCTAAGAACCTGAGAGG - Intronic
1156050744 18:32930813-32930835 CAGGAGGCTAATAGCATCAGGGG - Intergenic
1161957926 19:7506611-7506633 CATAGGGCTAAGAAGGTCAGGGG - Intronic
1166718893 19:44986423-44986445 CATGGGGGGAAGGACCTCAGAGG - Intronic
1168390627 19:56004509-56004531 GAAGTGGCTAAGAACCTCATTGG + Intronic
926807444 2:16724141-16724163 CAGGTGGCACAGAACCTCAGTGG + Intergenic
927248041 2:20973785-20973807 CCTGAGGCTGAGAACTACAGTGG + Intergenic
929865022 2:45710357-45710379 CAAGAGGCTGTGTACCTCAGTGG - Intronic
931838750 2:66127294-66127316 CATGAGGCTGGGATTCTCAGGGG + Intergenic
935678387 2:105615930-105615952 CATGAGGCTGATAACTTTAGGGG + Intergenic
936737515 2:115464510-115464532 CAAGATGCTAACAGCCTCAGGGG - Intronic
942226440 2:173820844-173820866 TATGAGGCTAAGATGTTCAGTGG - Intergenic
944776395 2:202970231-202970253 CTTGGGGCTAAGAAACTCAATGG - Intronic
1169820296 20:9702838-9702860 CATGAGGCCCAGAACAACAGAGG - Intronic
1170478345 20:16739531-16739553 CAAGAGGAGAAAAACCTCAGTGG - Intronic
1180711333 22:17841663-17841685 GATGAGGCTAAGAACCTAAAAGG + Intronic
1181472329 22:23148383-23148405 CATGAGATGAAGAACCTCATTGG + Intronic
951698675 3:25472256-25472278 GATGATGCTAAGAACCTAAGAGG - Intronic
954427817 3:50452762-50452784 CAAGAGTCAAAGATCCTCAGGGG + Intronic
954902951 3:54035514-54035536 TTTGAGGCAAAGGACCTCAGAGG + Intergenic
961820767 3:129574642-129574664 GAAGGGGCTAAGAACCTCAGGGG - Intronic
963065523 3:141260776-141260798 CCTGAGCCTAGGAATCTCAGTGG - Intronic
963105457 3:141643424-141643446 AATCAGGCAAAGAATCTCAGAGG + Intergenic
963635343 3:147787778-147787800 CATGATGCTGAGGACCTCAAAGG - Intergenic
965176591 3:165343125-165343147 CATGAAGCTAAGAACCTACATGG + Intergenic
965322902 3:167269555-167269577 CATCAAGCTAAAAACCCCAGAGG + Intronic
971266335 4:25099324-25099346 CAGGATGCTAACAGCCTCAGAGG + Intergenic
972281049 4:37602463-37602485 CATGAGGCTATGGAACTCTGTGG + Intronic
973562195 4:52148527-52148549 CCTGAGGGTCAGAACCTCAAGGG - Intergenic
976951462 4:90836729-90836751 CATGTCCCTCAGAACCTCAGAGG + Intronic
977742708 4:100505573-100505595 CATGAGGCAAGGAACTACAGAGG + Intronic
983153286 4:164312689-164312711 TATGAGACTAAGAACTTCTGTGG - Intronic
984055374 4:174922526-174922548 CACGAGCATAAGAAACTCAGAGG + Intronic
986728229 5:10615924-10615946 AAAGAGGCTGAAAACCTCAGTGG + Intronic
991971879 5:72149265-72149287 AATGAGGCTTAAGACCTCAGAGG - Intronic
993838704 5:92848566-92848588 CATGAGGCTTTTATCCTCAGTGG + Intergenic
997666288 5:135632016-135632038 CAGGAGGCCAAGAACCACATAGG - Intergenic
997804717 5:136905748-136905770 CCTTAGGCTAAAAGCCTCAGAGG + Intergenic
999234313 5:150081291-150081313 CAGGAGGCTGAGGACCCCAGGGG - Intronic
999362739 5:150999504-150999526 CAAGAGGCTTTGAACCTTAGGGG - Intergenic
1001172214 5:169430377-169430399 CAGAAGGATAAGAACCTAAGGGG + Intergenic
1001936669 5:175710381-175710403 CAAGAGACTAAGCACCTCTGGGG - Intergenic
1003423181 6:5976284-5976306 CATGGGGCTTAGAATCTAAGAGG - Intergenic
1012655853 6:101819507-101819529 TCTGTGGCTAAGGACCTCAGTGG + Intronic
1015068601 6:129061118-129061140 TTTGAGGCTAAGATCCCCAGGGG - Intronic
1021979419 7:26040063-26040085 CATGAGGAGGAGAAACTCAGAGG + Intergenic
1022220776 7:28311579-28311601 AAAGAGACTAAGAACATCAGTGG - Intronic
1023992879 7:45140137-45140159 CATGAGTCTAAGAGCTTGAGAGG - Intergenic
1027915244 7:84309406-84309428 GATGAGGCTATGAAGGTCAGTGG + Intronic
1028338471 7:89687825-89687847 AGTCAGGCTGAGAACCTCAGTGG + Intergenic
1028971491 7:96863635-96863657 CATGAGGCACAGACCCTCACAGG + Intergenic
1032105751 7:129027763-129027785 CAAGAGGCTAAGAAGCTGAAGGG + Intronic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1035704038 8:1661239-1661261 CATGAGGCGCAGCACCTCAGCGG - Intronic
1038450310 8:27634968-27634990 CATGAGGCAGGGAACCTCCGAGG + Intronic
1039077825 8:33708480-33708502 CATGGGGCTCAGGACCCCAGCGG - Intergenic
1039689569 8:39849725-39849747 CATCAAGCTAAAAACCCCAGAGG - Intergenic
1042807933 8:72792094-72792116 AATGGGGCTGAGAAACTCAGTGG + Intronic
1044944270 8:97376102-97376124 CCTGACACTAAGAACCACAGGGG - Intergenic
1049714530 8:144083584-144083606 CATGGGGCCAGGAAGCTCAGTGG + Intronic
1057967298 9:99516692-99516714 CATGAAGCTCAGAATCTCATGGG - Intergenic
1062076460 9:134592619-134592641 CCTGAGTCTAGGAACCCCAGGGG - Intergenic
1187590964 X:20716882-20716904 CACTAGGCTAAGCACCTTAGGGG - Intergenic
1189046963 X:37603575-37603597 CACAAGTCTAAGAACCACAGTGG - Intronic
1196055151 X:111347808-111347830 TATGGGGCTAAGAAGATCAGTGG - Intronic
1196601581 X:117606899-117606921 GGTGAGGCTAAGAACCAAAGAGG + Intergenic
1196744155 X:119054376-119054398 CCTGAGGGTAAGAACCTAAGGGG - Intergenic
1198938018 X:141919438-141919460 CATCAGGCCAAGATCCTCAATGG + Intergenic
1199444830 X:147910470-147910492 CATGAGGCCAAGAACCCAATAGG - Intergenic
1200228797 X:154433841-154433863 CATGAGGCACAGAACCCCTGTGG + Intronic