ID: 1148236927

View in Genome Browser
Species Human (GRCh38)
Location 17:45975200-45975222
Sequence CCATTGGTTTGGTGATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 7, 3: 100, 4: 553}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148236920_1148236927 30 Left 1148236920 17:45975147-45975169 CCTGGAGTCATTTCCTTCATGTC 0: 1
1: 1
2: 1
3: 20
4: 261
Right 1148236927 17:45975200-45975222 CCATTGGTTTGGTGATTTGGAGG 0: 1
1: 0
2: 7
3: 100
4: 553
1148236921_1148236927 17 Left 1148236921 17:45975160-45975182 CCTTCATGTCTTCTTCACTGCAC 0: 1
1: 0
2: 1
3: 28
4: 311
Right 1148236927 17:45975200-45975222 CCATTGGTTTGGTGATTTGGAGG 0: 1
1: 0
2: 7
3: 100
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148236927 Original CRISPR CCATTGGTTTGGTGATTTGG AGG Intronic
900437144 1:2636271-2636293 CCTTTGGCTTAGTGATTTTGGGG + Intronic
901147919 1:7080211-7080233 CCTTTGGTTGTATGATTTGGGGG - Intronic
902923996 1:19683552-19683574 TCATGGGTTTGGTGATTCGTTGG - Intronic
902971213 1:20052749-20052771 CCTTTAGCTTAGTGATTTGGGGG - Intronic
903231384 1:21924413-21924435 ACATGGGATTGGTGATATGGTGG + Intronic
903596049 1:24495623-24495645 CCTTTGGCTTAGTGATTTGGGGG + Intergenic
903699362 1:25235138-25235160 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
904347191 1:29880560-29880582 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
904398491 1:30239943-30239965 CCTTTGGCTTAGTGATTTGGCGG - Intergenic
904449861 1:30603990-30604012 CCCTTGGCTTAGTGATTTTGGGG - Intergenic
904487581 1:30837461-30837483 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
906343675 1:45002300-45002322 GCATGGATATGGTGATTTGGAGG - Intergenic
906590168 1:47017567-47017589 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
906817356 1:48892775-48892797 CCTTTTGCTTAGTGATTTGGGGG + Intronic
907500631 1:54877167-54877189 CCCTTAGTTTAGTAATTTGGGGG + Intronic
907624095 1:56011352-56011374 GAATTGGTGTGGTCATTTGGAGG - Intergenic
907845912 1:58206473-58206495 CCTTTGGCTTAGTGATTTGGAGG + Intronic
910121658 1:83797079-83797101 CCTTTGGCTTAGTGATTTGGGGG + Intergenic
910203278 1:84722263-84722285 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
910486264 1:87717817-87717839 CCCTTGGTTTGGTTTCTTGGAGG - Intergenic
911130290 1:94380885-94380907 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
911317258 1:96370259-96370281 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
912056112 1:105599849-105599871 CCTTTGGCTTAGTGATTTGCGGG + Intergenic
912669942 1:111616339-111616361 CCATTGGTTTGGAGAGGTTGAGG - Intronic
912981333 1:114376049-114376071 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
913370457 1:118093431-118093453 TCAGTGGTTTGGAGATTTAGGGG - Intronic
914708689 1:150192980-150193002 CTATTGCTTTAGTTATTTGGAGG - Intergenic
915046440 1:153021300-153021322 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
915219368 1:154361955-154361977 CCCTTGGCTTAGTGATTTTGGGG - Intergenic
915270175 1:154748047-154748069 CCATTGGTTGGTTGGTTTGTCGG + Intronic
916623420 1:166526789-166526811 CCCTTAGCTTTGTGATTTGGGGG - Intergenic
916623922 1:166533090-166533112 TCATTAGCTTAGTGATTTGGGGG - Intergenic
916928999 1:169555006-169555028 GAATTTCTTTGGTGATTTGGGGG + Intronic
917099352 1:171430053-171430075 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
917636525 1:176942546-176942568 CCTTTCGCTTAGTGATTTGGGGG - Intronic
918005271 1:180535958-180535980 CCTTTGGCTTAGCGATTTGGGGG + Intergenic
918161020 1:181899784-181899806 CCCTTGGCTTAGTGATTTGGGGG - Intergenic
918298246 1:183178060-183178082 CCTTTGGCTTAGTGATTTGGGGG + Intergenic
918467229 1:184833090-184833112 ACATTACATTGGTGATTTGGAGG + Intronic
918720126 1:187841963-187841985 CCTTTGGCTTAGTGATTTTGAGG + Intergenic
918944491 1:191045008-191045030 TCATTGGTTAGCTCATTTGGTGG + Intergenic
919018253 1:192068997-192069019 CCATGGGTTTAGTGGTTGGGCGG + Intergenic
920023975 1:202978381-202978403 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
920539316 1:206766264-206766286 CCTTTAGCTTGGTGATTTTGAGG + Intergenic
921343679 1:214159695-214159717 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
921680296 1:218023251-218023273 CCTTTAGATTAGTGATTTGGGGG - Intergenic
921828078 1:219696168-219696190 ACATTGGTTTGGTCAATTTGGGG - Intronic
922217239 1:223530128-223530150 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
922913233 1:229234682-229234704 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
923245473 1:232126924-232126946 CCTTTAGTTTAGTGATTTGGGGG + Intergenic
923341027 1:233007259-233007281 CCATTTGTATGGTGACTTGTGGG + Intronic
923536092 1:234853027-234853049 CCCTTGGATTAGTGATTTTGCGG + Intergenic
923600578 1:235399283-235399305 CCATTAGTTTGGAGTTGTGGTGG + Intronic
923662249 1:235968471-235968493 CAATGGGTTTGGGGATTGGGCGG + Intergenic
1062869059 10:882924-882946 GCATTGGTTTAGTGATTAGGTGG - Intronic
1063544939 10:6971528-6971550 GCTTTGATTGGGTGATTTGGGGG + Intergenic
1064629717 10:17297246-17297268 TCACTGGTTTGTTGATTTGGGGG + Intergenic
1064740986 10:18434467-18434489 GCATTGGTTGGGTGATTTTCAGG + Intronic
1065810841 10:29441818-29441840 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1066066228 10:31762968-31762990 CCTTTGGCTTAGTGATTTGGGGG + Intergenic
1066317517 10:34262774-34262796 CCTTTGGTTTGGTAATTTGAAGG - Intronic
1067164984 10:43858464-43858486 CCATTGCATTGGTGTTTGGGGGG - Intergenic
1067855527 10:49789360-49789382 CCTTTGCTTTAGTGATTTGGGGG - Intergenic
1069253268 10:66298885-66298907 CCTTTAGATTAGTGATTTGGGGG - Intronic
1069273674 10:66563559-66563581 TCTTTGGTTTAGTGATTTTGGGG - Intronic
1069356485 10:67592398-67592420 CCCTTTGTTTGGTGAGTGGGAGG - Intronic
1070252399 10:74784452-74784474 CCTTTAGTTTAGTAATTTGGGGG + Intergenic
1070936042 10:80295990-80296012 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1071828906 10:89352693-89352715 CCTTTGGCTTAGTGACTTGGGGG - Intronic
1071926701 10:90417416-90417438 CCTTTGGCTTAGTAATTTGGGGG - Intergenic
1072213710 10:93270596-93270618 CCTTTTGCTTAGTGATTTGGGGG + Intergenic
1073500113 10:103929189-103929211 CCTTTGGTTTAGTGATTTGGGGG + Intergenic
1073518933 10:104106833-104106855 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1073531610 10:104237717-104237739 CCTTTGGCTTAGTGATTTGAGGG + Intronic
1073679297 10:105684911-105684933 ACATTGGCTTGGTGATTAAGTGG - Intergenic
1073907610 10:108301527-108301549 CCATTTATTTTGTGATTTTGTGG + Intergenic
1074649778 10:115507288-115507310 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1075423926 10:122327252-122327274 CCATAACTTGGGTGATTTGGAGG + Intronic
1075838080 10:125473365-125473387 GCTTTGGTTGGGTGATTTGGGGG + Intergenic
1075950770 10:126475941-126475963 CCATGGTTTTGGTGCTTTGTGGG + Intronic
1076202844 10:128572012-128572034 CCGTTGGTTTGGGGGTATGGAGG - Intergenic
1076551454 10:131280612-131280634 CCTTTAGCTTGGTAATTTGGGGG + Intronic
1076977827 11:188889-188911 CCCTTGGCTTAGTGATTTGGGGG - Intronic
1077038170 11:505293-505315 CCACAGGTTTGGAGATTAGGAGG - Intronic
1077874213 11:6289948-6289970 CCTTTGGCTTAGTGATTTGGGGG + Intergenic
1078051523 11:7969024-7969046 CCTTTGGCTTAGTGATTTGGGGG + Intergenic
1078290319 11:10004480-10004502 CCTTTGGCTTGGTGGTTTGGGGG - Intronic
1078627090 11:12967716-12967738 GCATTGGTTTCTAGATTTGGAGG + Intergenic
1080752821 11:35166506-35166528 GCATTGGGTTGATCATTTGGTGG + Intronic
1080820198 11:35798370-35798392 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1081302660 11:41471741-41471763 TCACTGGTTTGGTTATTTTGAGG + Intergenic
1081323354 11:41717233-41717255 CCTTTGGCTTAGTGATTTGGGGG - Intergenic
1082128266 11:48456948-48456970 CCATGGGGTTGGAGGTTTGGGGG - Intergenic
1082192969 11:49269357-49269379 CCCTTGGCTTAGTAATTTGGGGG + Intergenic
1082561816 11:54627873-54627895 CCATGGGGTTGGAGGTTTGGGGG - Intergenic
1083130205 11:60618111-60618133 CCTTTGCTGTGGTGATTGGGTGG + Intergenic
1083200120 11:61115979-61116001 ACATTGGTGGGGTGATTTGCAGG - Intronic
1083339305 11:61948568-61948590 CCAGTGGTTTGGAGAGTTGACGG + Intergenic
1084228863 11:67735766-67735788 CCAGTTGTTTGCTGATTTTGTGG - Intergenic
1084674285 11:70625027-70625049 CCTCAGGTTTGGTGATTTGTGGG + Intronic
1085553271 11:77395211-77395233 CCATTGCTTTGGGAATATGGAGG - Intronic
1086128001 11:83369511-83369533 CCTTTAGCTTGGTGATTTTGGGG + Intergenic
1086673160 11:89571717-89571739 CCCTTGGCTTAGTAATTTGGGGG - Intergenic
1087013099 11:93531751-93531773 CCTTTAGCTTAGTGATTTGGGGG - Intronic
1087047388 11:93853458-93853480 CCTTTAATTTAGTGATTTGGGGG + Intergenic
1087049625 11:93872326-93872348 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1087145609 11:94807994-94808016 CCTTTGGCTTAGTGATTTTGGGG - Intronic
1087146048 11:94812712-94812734 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1088231129 11:107674375-107674397 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1088594552 11:111430634-111430656 CCCTTGGCTTAGGGATTTGGGGG + Intronic
1090100772 11:123794644-123794666 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1090453251 11:126825048-126825070 CCTTTGGCTTAGTGATTTGGGGG + Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1090921796 11:131213295-131213317 CCTTTGGCTTAGTGATTTCGGGG - Intergenic
1091165367 11:133470961-133470983 CAGTTAGTTTGTTGATTTGGTGG - Intronic
1091689241 12:2584451-2584473 CCCTTGGTTTGGGGTTTTGGTGG - Intronic
1092757851 12:11780931-11780953 CCTTTGGTGTGCTGATCTGGGGG - Intronic
1092852597 12:12644196-12644218 CTATTTATTTGGTGTTTTGGAGG + Exonic
1093057607 12:14570239-14570261 CCCTTGGCTTAGTGATTTTGGGG - Intergenic
1093737736 12:22641196-22641218 GGATTTGTCTGGTGATTTGGGGG + Intronic
1094695390 12:32813208-32813230 CCATTTGTTTGGTTGTTTGGGGG - Intronic
1094742619 12:33307189-33307211 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
1094745854 12:33343392-33343414 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1094772766 12:33684642-33684664 CCTTTGGCTTAGTGATTTGGGGG - Intergenic
1095266208 12:40161050-40161072 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1095541341 12:43311871-43311893 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1095584357 12:43834618-43834640 CCAGTGGTGTGGGGATGTGGGGG + Intergenic
1097235374 12:57535908-57535930 CTAATGGTTTGGGGATTTTGTGG - Intronic
1097555550 12:61133188-61133210 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
1098358303 12:69631303-69631325 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1098486090 12:71023624-71023646 CCCTTGGCTTAGTGATTTTGAGG + Intergenic
1098666580 12:73170770-73170792 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
1100121387 12:91373103-91373125 CCTTTGGCTTAGTGATTTGGGGG - Intergenic
1100480192 12:94970469-94970491 CCCTTGGCTTAGTGATTTTGGGG + Intronic
1100710597 12:97252167-97252189 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1100755730 12:97749222-97749244 CCTTTGGCTTAGTGATTTGGGGG - Intergenic
1101485543 12:105154834-105154856 ACTTTGGTCTGATGATTTGGAGG + Intronic
1103111772 12:118286114-118286136 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1103211727 12:119172028-119172050 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1103213214 12:119181541-119181563 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1103947598 12:124535218-124535240 ACATTGCTTTTGTGCTTTGGCGG - Intronic
1104321585 12:127756548-127756570 CCATTAGCTTAGTGATTTTGGGG - Intergenic
1104453718 12:128892218-128892240 CCTTTAGCTTTGTGATTTGGGGG + Intronic
1104538808 12:129643591-129643613 CCTTTAGCTTAGTGATTTGGGGG - Intronic
1104640934 12:130466550-130466572 CCTTTGGCTTGGTGATTGTGGGG - Intronic
1104659395 12:130599845-130599867 CCTTTAGCTTAGTGATTTGGGGG - Intronic
1105744648 13:23365873-23365895 CCATTTGTTTGGTGAATGGTGGG + Intronic
1106937469 13:34738972-34738994 CCTTTTGTTTTGTTATTTGGTGG - Intergenic
1107174551 13:37385232-37385254 CTCTTGGCTTAGTGATTTGGGGG - Intergenic
1107518806 13:41159221-41159243 CCTTTGGCATTGTGATTTGGGGG + Intergenic
1107530024 13:41274102-41274124 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1107949343 13:45447705-45447727 CCTTTGGCTTAGTGATTTGAGGG - Intergenic
1108271690 13:48767252-48767274 CCCTTGGCTTGGTGATTTTTGGG + Intergenic
1108379541 13:49842929-49842951 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1109142102 13:58726825-58726847 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1109423148 13:62139378-62139400 CCATTAGCGTAGTGATTTGGGGG - Intergenic
1109433812 13:62272599-62272621 CCTTTAGCTTGGTGATTTTGGGG + Intergenic
1109744659 13:66608562-66608584 CTATTAGTTTGGGGAATTGGAGG - Intronic
1109903559 13:68807660-68807682 CCATTGGTTTAGTATTCTGGAGG - Intergenic
1110605405 13:77426541-77426563 CCCTTGGCTTGGTGATTTTGGGG - Intergenic
1110969297 13:81740755-81740777 CCTTTAGCTTCGTGATTTGGGGG - Intergenic
1111135535 13:84037484-84037506 CCTTTAGCTTCGTGATTTGGTGG + Intergenic
1111507246 13:89208459-89208481 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1111509430 13:89241884-89241906 CCATGGGTTTGGTTATCAGGAGG + Intergenic
1112207240 13:97336980-97337002 CCGTTGGTTTGGTAATATGGAGG - Intronic
1112730389 13:102353997-102354019 CCTTTGGCTTAGTGATTTTGGGG - Intronic
1113384185 13:109833227-109833249 CCATTGGTTTTGGGAGGTGGAGG - Intergenic
1113417031 13:110136631-110136653 CCATTAGCTTAGTGACTTGGGGG + Intergenic
1113528663 13:111003181-111003203 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1114504578 14:23199475-23199497 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1114505366 14:23208097-23208119 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1114510012 14:23251020-23251042 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1116086278 14:40242616-40242638 CTTTTGGTTCAGTGATTTGGGGG - Intergenic
1116093308 14:40335934-40335956 CCTTTGGCTTTGTGATTTTGGGG + Intergenic
1116173129 14:41428675-41428697 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1116653988 14:47628043-47628065 CCATAGTTTTGGGGTTTTGGTGG + Intronic
1117416493 14:55501272-55501294 CCTTTGGCTTCGTGATTTTGGGG - Intergenic
1117587581 14:57226273-57226295 CCTTTGGCTTAGTGATTTGGGGG + Intronic
1118024557 14:61755777-61755799 CCCTTGGTTTAGTGATTTTGTGG - Intergenic
1118631371 14:67706713-67706735 CCTTTGGCTTTGTGATTTTGGGG + Intronic
1118938897 14:70314514-70314536 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1119042701 14:71289485-71289507 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1119450405 14:74704602-74704624 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1120002999 14:79324656-79324678 CCATTGGATTTGGGATTGGGTGG + Intronic
1120169958 14:81238160-81238182 CCTTTAGTTTAGTGACTTGGGGG + Intergenic
1120769774 14:88366287-88366309 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1120966460 14:90171848-90171870 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1121087036 14:91154613-91154635 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1121760610 14:96441729-96441751 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1122187060 14:100007424-100007446 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1122434535 14:101685475-101685497 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1122949142 14:105031325-105031347 CCGTTGGCTTAGTGATTTTGGGG - Intergenic
1123051291 14:105545430-105545452 CCTGGGGGTTGGTGATTTGGGGG - Intergenic
1123076703 14:105671132-105671154 CCTGGGGGTTGGTGATTTGGGGG - Intergenic
1123142125 14:106090421-106090443 CATTTGGCTTAGTGATTTGGGGG + Intergenic
1123146090 14:106131835-106131857 CCTTTGGCTTAGTGATATGGGGG + Intergenic
1123200671 14:106660441-106660463 CCTTTGGCTTAGTGATTTGGGGG + Intergenic
1202943236 14_KI270726v1_random:3001-3023 CCTTTGGCTTAGTGATTTGGGGG - Intergenic
1124127594 15:26951128-26951150 CCCTTGCTTTAGTGATTTTGGGG - Intergenic
1124663989 15:31576041-31576063 CCTTTGGCTTAGTGATTTTGGGG - Intronic
1124665017 15:31585017-31585039 AGATGGGTTTGGTGACTTGGAGG + Intronic
1125157134 15:36600561-36600583 TCATTGATATGGTGATTAGGTGG + Intronic
1126221082 15:46214054-46214076 ACATTGGTTTGTTGACCTGGGGG + Intergenic
1126634700 15:50769003-50769025 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
1126946203 15:53823261-53823283 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1127102110 15:55576908-55576930 CCCTTGGCTTAGTGATTTTGGGG - Intronic
1127114917 15:55716613-55716635 CTAATGGTCTGGTGATTTAGGGG - Intronic
1127229093 15:56969221-56969243 CCCTTGGCTTAGTGATTTTGGGG + Intronic
1127901410 15:63343832-63343854 TCTTTGGCTTAGTGATTTGGGGG - Intronic
1128832281 15:70780341-70780363 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1129083892 15:73068067-73068089 TCATTAGTTTGGTGGTTTGCAGG + Intronic
1131529262 15:93178371-93178393 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1132183685 15:99783419-99783441 ACATTGGTTTGATGATTTTGTGG + Intergenic
1132407175 15:101550688-101550710 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
1133408038 16:5541672-5541694 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1133682185 16:8130041-8130063 CTGTTGGCTTAGTGATTTGGGGG + Intergenic
1133697819 16:8281605-8281627 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1133941827 16:10315873-10315895 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
1134279801 16:12807498-12807520 CCCTTGGCTTAGTGATTTTGGGG - Intergenic
1134369520 16:13610062-13610084 CCCTTGGTTTAGTGATTTGGGGG - Intergenic
1134371680 16:13631876-13631898 CCTTTGGCTTAGTGATTTGGGGG - Intergenic
1135224020 16:20639832-20639854 CCTTTGGCTTAGTGATTTTGGGG - Intronic
1135376268 16:21950006-21950028 CCTTTGGCTTAGTGATTTGGAGG + Intergenic
1135383333 16:22011826-22011848 CCATTCGTTTTATGTTTTGGGGG - Intronic
1135748513 16:25037621-25037643 GCTTTGGCTGGGTGATTTGGGGG + Intergenic
1135751719 16:25063675-25063697 GCTTTGGCTGGGTGATTTGGGGG + Intergenic
1135751793 16:25064286-25064308 GCTTTGGCTGGGTGATTTGGGGG - Intergenic
1135758300 16:25116163-25116185 GCTTTGGCTGGGTGATTTGGGGG + Intronic
1136045349 16:27610733-27610755 CCTTTAGTTTAGTGATTTGGGGG - Intronic
1136693023 16:32049950-32049972 CCTTGGGCTTAGTGATTTGGTGG - Intergenic
1136793517 16:32993176-32993198 CCTTGGGCTTAGTGATTTGGTGG - Intergenic
1136876392 16:33861211-33861233 CCTTCGGCTTAGTGATTTGGTGG + Intergenic
1137417049 16:48292449-48292471 CCTTTTGCTTAGTGATTTGGGGG + Intronic
1140419417 16:74806355-74806377 CCTTTAGTTTAGTGATTTGGGGG - Intergenic
1140874814 16:79141033-79141055 CCTTTAGCTTAGTGATTTGGGGG - Intronic
1141066620 16:80919221-80919243 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1141429048 16:83961529-83961551 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1142442505 16:90108440-90108462 CCCTTGGCTTAGTGATTTGGGGG + Intergenic
1203095779 16_KI270728v1_random:1254866-1254888 CCTTGGGCTTAGTGATTTGGTGG - Intergenic
1203141062 16_KI270728v1_random:1766281-1766303 CCTTTAGTTTTGTGATTTTGGGG + Intergenic
1142465248 17:133354-133376 CCCTTGGCTTAGTGATTTGGGGG - Intergenic
1142744982 17:1951836-1951858 CCACTGATTTGGCGACTTGGAGG + Intronic
1142914211 17:3121680-3121702 CCATAGGTTTGGGGATGTGCAGG - Intergenic
1143412790 17:6721972-6721994 CCATTAGATCAGTGATTTGGAGG - Intergenic
1146726471 17:35160389-35160411 CCTTTGGTTTAGGGAGTTGGGGG + Intronic
1147512913 17:41087471-41087493 CCTTTAGCTTAGTGATTTGGGGG - Intronic
1147514971 17:41107509-41107531 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1148221563 17:45866029-45866051 CCTTTGGCTTAGTGATTTGGGGG + Intergenic
1148236927 17:45975200-45975222 CCATTGGTTTGGTGATTTGGAGG + Intronic
1148949957 17:51302096-51302118 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1148951566 17:51317943-51317965 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1149266647 17:54934324-54934346 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1150687001 17:67328940-67328962 TTATTGGTCTGGTGATTAGGAGG + Intergenic
1151026836 17:70686795-70686817 CCTGTGGTTTGGTGGTTTGGGGG + Intergenic
1151982492 17:77521738-77521760 CCTTTGGCTTGGTGATTTGGGGG - Intergenic
1153063986 18:1024017-1024039 CCCATTGTTGGGTGATTTGGGGG + Intergenic
1153526194 18:5997215-5997237 CCCTTGATTTAGTGATTTTGGGG - Intronic
1153851569 18:9100215-9100237 CCCTTGGCTTAGTGATTTGGGGG + Intergenic
1154407943 18:14113199-14113221 CCTTTAGCTTAGTGATTTGGGGG - Intronic
1155120460 18:22814282-22814304 CCTTTAGTTTAGTGATTTAGTGG - Intronic
1155232854 18:23791766-23791788 ACATTTGTTTGGTTTTTTGGGGG - Intronic
1155282587 18:24255381-24255403 CCCTTAGTTTAGTAATTTGGGGG - Intronic
1155828245 18:30477287-30477309 CCATTTGTTTGCTTATTTTGGGG - Intergenic
1156644213 18:39140448-39140470 CCTTTGGCTTAGTGATTTGGGGG + Intergenic
1157485205 18:48082103-48082125 ACAATGGTTTGGGGACTTGGGGG + Intronic
1158189630 18:54811845-54811867 CCTTTGGCTTAATGATTTGGGGG + Intronic
1158693227 18:59680351-59680373 CCTTTAGTTTAGCGATTTGGGGG + Intronic
1159879338 18:73843891-73843913 CCCTTAGTGTGGGGATTTGGAGG - Intergenic
1162151954 19:8652619-8652641 CCATTGATTTAGTGACTTGCTGG + Intergenic
1162198347 19:9003107-9003129 CCTTTGGCTTTGTGATTTTGGGG - Intergenic
1163087782 19:14994675-14994697 CCTTTGGCTTAGTGATTTTGGGG - Intronic
1164137861 19:22429599-22429621 CTTTTGGCCTGGTGATTTGGGGG + Intronic
1164392021 19:27832224-27832246 ACATAGGATTGGAGATTTGGAGG + Intergenic
1165609443 19:37137793-37137815 CCTTTGGTTTAGTGATTTTGGGG - Intronic
1166627209 19:44369307-44369329 CCTCTGGCTTGGTGATTTGGGGG - Intronic
1167537277 19:50062260-50062282 CCACTGGTTTGGCGATTTTCCGG - Intergenic
1168247655 19:55121600-55121622 CAATAGTTTTGGTGAATTGGAGG - Intergenic
926538260 2:14141547-14141569 GCATTGGTTTTGGGACTTGGAGG - Intergenic
926711740 2:15887686-15887708 CCATTTGTGTGCTGATTTTGTGG - Intergenic
927033981 2:19152502-19152524 CCTTTGGTTTACTGATTTAGGGG + Intergenic
927673051 2:25084936-25084958 CCTTTAGCTTAGTGATTTGGGGG + Intronic
928319515 2:30271948-30271970 CATTTGGATTGGTGAATTGGTGG + Intronic
928347398 2:30513625-30513647 CCTTTAGCTTAGTGATTTGGGGG - Intronic
928775389 2:34755149-34755171 CCTTTTGTTAGGTGATTTGGGGG - Intergenic
928834641 2:35529383-35529405 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
930229549 2:48828830-48828852 CAACTGGTATGGTCATTTGGAGG - Intergenic
930494671 2:52126327-52126349 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
931054151 2:58449954-58449976 CCATTGGTGTGGGGGTTTGAAGG - Intergenic
931073926 2:58687579-58687601 CCATTGCTTTAATGCTTTGGTGG + Intergenic
932080511 2:68710286-68710308 CCATTTGTTTGGAGATTTAATGG - Intronic
932109226 2:68979835-68979857 CCAGTGGTTTGTTGACTTGAGGG - Intronic
932482236 2:72051126-72051148 CCTTTGGCTTAGTGATTTTGAGG - Intergenic
933052542 2:77617760-77617782 CCTTTAGTTTAGTGATTTTGGGG - Intergenic
933089684 2:78105250-78105272 CCATGGGATTGGAGATTGGGGGG + Intergenic
933196866 2:79400370-79400392 CCTTTGGCTTAGTGATTTTGGGG + Intronic
933620303 2:84531285-84531307 CCTTTCGTTTAGTGATTTGGGGG + Intronic
934108212 2:88715901-88715923 CCCTTGGCTTAGTGATTTGGGGG - Intronic
934700254 2:96433865-96433887 ACATTGGTTTGGAGAGTTGTAGG - Intergenic
934887026 2:98033795-98033817 CCCTTGGCTTTGTGATTTTGAGG - Intergenic
934888193 2:98042997-98043019 CCTTTGGCTTAGTGATTTGTGGG - Intergenic
934955208 2:98611638-98611660 CCTTTGGCTTAGTGATTTTGGGG + Intronic
936477145 2:112849132-112849154 CCTTTAGCTTAGTGATTTGGAGG - Intergenic
936478461 2:112863112-112863134 CCTTTAGCTTTGTGATTTGGAGG - Intergenic
936940109 2:117876028-117876050 CCTTTAGCCTGGTGATTTGGGGG - Intergenic
938546286 2:132335247-132335269 CCTCTGGCTTAGTGATTTGGGGG + Intergenic
939182902 2:138824658-138824680 CTATTGTTTTGGAGTTTTGGGGG - Intergenic
939286574 2:140138600-140138622 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
939339613 2:140877523-140877545 CCTTTAGCTTAGTGATTTGGGGG - Intronic
939376440 2:141374901-141374923 CCATTGTTGTGGTCCTTTGGTGG + Intronic
939672846 2:145034848-145034870 CCATTGGTATGGAGTTTTGGTGG - Intergenic
939857495 2:147377749-147377771 CCAGTGGTTTGGAGAGATGGAGG + Intergenic
940091818 2:149928327-149928349 TCATTCCTGTGGTGATTTGGAGG + Intergenic
941405528 2:165083093-165083115 CCCTTGGCTTAGTGATTTTGGGG - Intergenic
941760408 2:169235828-169235850 CCAGTGATTTGGTAAGTTGGTGG - Exonic
941927915 2:170914689-170914711 CCAGTGGGTTGGTGGGTTGGTGG + Intergenic
942339286 2:174926422-174926444 CCTTTGGCTTAGTGATTTGGGGG - Intronic
943256402 2:185599021-185599043 CCTTTGCTTTAGTGATTTTGGGG + Intergenic
943256475 2:185599657-185599679 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
945790620 2:214300362-214300384 CCATTGGTTTAGTGTTTTGCTGG + Intronic
945934190 2:215886447-215886469 CCTTTGGCTTGGTGATTTTAGGG - Intergenic
945984831 2:216345187-216345209 CCTGTGGTTTGCTGGTTTGGAGG + Intronic
946344182 2:219094942-219094964 CCTCTGTTTTGGTGGTTTGGAGG - Intronic
948005088 2:234601750-234601772 CTATTGGCTTAGTGATTTGGGGG + Intergenic
1171875147 20:30567980-30568002 CCTCTGGCTTAGTGATTTGGGGG + Intergenic
1173182927 20:40818205-40818227 CCATTGAGTGGGTGGTTTGGGGG - Intergenic
1173183210 20:40820140-40820162 CCATTGAGTGGGTGGTTTGGGGG - Intergenic
1173626170 20:44474614-44474636 GCATTCTTTTGGGGATTTGGAGG - Intergenic
1174145851 20:48451965-48451987 GCCCTGGTTTGCTGATTTGGGGG + Intergenic
1174265423 20:49328377-49328399 CACTTGGTGTGGTGTTTTGGGGG + Intergenic
1175058456 20:56219562-56219584 CCTTTGGCTTAGTGATTTTGTGG + Intergenic
1175646116 20:60673240-60673262 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1175929453 20:62486818-62486840 CCATAGCTTTGGTGCTTGGGAGG + Intergenic
1176021175 20:62963193-62963215 CCAAAGGATTGGGGATTTGGGGG - Intronic
1176363722 21:6019906-6019928 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1177198008 21:17923185-17923207 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1177254674 21:18645510-18645532 CCTTTGGCTTAGTGATTTGTGGG + Intergenic
1177360588 21:20064159-20064181 CCCTTGGCTTAGTGATTTTGGGG - Intergenic
1177814491 21:25961047-25961069 CCTTTAGCTTAGTGATTTGGGGG - Intronic
1178067542 21:28922452-28922474 CCATTAGCTTAGTGATTTTGGGG - Intergenic
1178118055 21:29437398-29437420 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1178512483 21:33217186-33217208 CCCTTGGCTTAGTGATTTTGGGG + Intergenic
1179260053 21:39750141-39750163 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1179299716 21:40096018-40096040 CCTTTAGCTTAGTGATTTGGGGG - Intronic
1179355292 21:40653209-40653231 CCCTTGGGTTGATGATTTGCTGG - Intronic
1179545302 21:42109356-42109378 ACATTGGTTGGCTTATTTGGGGG - Intronic
1179759796 21:43518639-43518661 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
1180112768 21:45671648-45671670 GCTTTGGTTAGGTGATTTGGGGG + Intronic
1180652086 22:17386188-17386210 CCTTTGAGTTGGTGATTTGAAGG + Intronic
1181917661 22:26293317-26293339 TCATTTGTTTGTTGTTTTGGGGG + Intronic
1184509903 22:44927282-44927304 CCGTTGGTTTGGAGTTTTGGGGG - Intronic
1184588969 22:45468286-45468308 CCTTTAGTTTAGTGATTTGGGGG - Intergenic
1184917880 22:47585436-47585458 CCATCAGCTTAGTGATTTGGGGG - Intergenic
1185095038 22:48801639-48801661 CCTTTAGCTTAGTGATTTGGGGG - Intronic
949493862 3:4613402-4613424 CCTTTAGCTTAGTGATTTGGGGG + Intronic
949560642 3:5198761-5198783 CCTTTGGCTTAGTGATTTTGGGG + Intronic
950297326 3:11843231-11843253 CCATTGGTCTGGTCAGTGGGAGG - Intronic
951407125 3:22314861-22314883 CCATCTGTTTGGTTTTTTGGGGG - Intronic
951882217 3:27490554-27490576 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
952420555 3:33127193-33127215 CCTTTGGCTTAGTGATTTTGAGG + Intronic
953493625 3:43369080-43369102 CATTGGGTTTGGTCATTTGGAGG - Intronic
954669890 3:52284710-52284732 CCTTTGTTTTGATGATGTGGTGG + Intronic
954932426 3:54295890-54295912 CCTTTGGCTTAGTGATTTTGGGG + Intronic
955424780 3:58776962-58776984 CATTTGGCTTAGTGATTTGGGGG - Intronic
955821171 3:62897155-62897177 ACATTGGATTGATGATCTGGAGG + Intergenic
956722412 3:72129916-72129938 ACATTGGATTTATGATTTGGAGG - Intergenic
958038080 3:88193318-88193340 ACTTTGGCTTAGTGATTTGGGGG - Intergenic
958953608 3:100442713-100442735 CCTTTAGCTTAGTGATTTGGGGG + Intronic
958954396 3:100451552-100451574 CCTTTAGCTTAGTGATTTGGGGG + Intronic
959331330 3:105009225-105009247 CCTTTAGTTTAGTGATTTTGGGG - Intergenic
959773277 3:110125561-110125583 CCTTTAGTTTAGTGATTTGGGGG - Intergenic
959969782 3:112396696-112396718 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
962120095 3:132552251-132552273 CTTTTGGCTTAGTGATTTGGGGG - Intergenic
962833305 3:139162981-139163003 CCCTTGGCTTAGTGATTTTGGGG + Intronic
962896641 3:139721419-139721441 CCACTGGTTTTGCCATTTGGAGG - Intergenic
964486480 3:157190480-157190502 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
964773700 3:160252832-160252854 CCCTTGGCTTAGTGATTTTGGGG + Intronic
964860840 3:161199281-161199303 CCTTTAGCTTAGTGATTTGGGGG - Intronic
965256303 3:166417430-166417452 CCTTTGGCTTAGTGATTAGGGGG + Intergenic
966059918 3:175742295-175742317 CCTTTGGCTTAGTGATTTGAAGG + Intronic
966756030 3:183372104-183372126 CCTTTGGCTTAATGATTTGGGGG + Intronic
966958255 3:184907503-184907525 CCTTTGGCTTAGTGATTTTGGGG + Intronic
967073351 3:185981213-185981235 GCATTGGTTGTGTGAATTGGGGG + Intergenic
967832399 3:193931541-193931563 CTATTGGTATGATCATTTGGAGG + Intergenic
967862442 3:194162095-194162117 CCCATGGTTTGGGGGTTTGGGGG + Intergenic
968131651 3:196195879-196195901 CCATTGGGCTGGAGATCTGGAGG + Intergenic
968362778 3:198159400-198159422 CCCTTGGCTTAGTGATTTGGGGG + Intergenic
968379242 4:74874-74896 CCTTTAGCTTAGTGATTTGGAGG + Intronic
968807241 4:2782361-2782383 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
968928345 4:3562073-3562095 CCCTTGGCTTGGTAATTTTGGGG + Intergenic
969030431 4:4208361-4208383 CCTTTGGCTTAGTGATTTTGGGG + Intronic
969357486 4:6638849-6638871 CCTTTGGTTTAGTGATTATGGGG + Intergenic
969424419 4:7115887-7115909 GCATTGGATAGGTGATGTGGAGG + Intergenic
969655320 4:8494120-8494142 CCTTTGGCTGAGTGATTTGGGGG - Intergenic
969961257 4:10946902-10946924 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
970699389 4:18716790-18716812 CCAAAGGCTTGGTGGTTTGGGGG - Intergenic
970853310 4:20627125-20627147 CCTGTAGCTTGGTGATTTGGGGG + Intergenic
970918039 4:21358671-21358693 CCTTTAGCTTAGTGATTTGGGGG - Intronic
970971300 4:21987547-21987569 CCTTTAGATTAGTGATTTGGGGG - Intergenic
971006803 4:22383311-22383333 CCTTTGGCTTAGTGATTTGGGGG + Intronic
971356047 4:25896177-25896199 TCATTGGCTGTGTGATTTGGGGG - Intronic
971913217 4:32823687-32823709 CCTTTAGTTTAGTGATTTTGGGG + Intergenic
972221718 4:36963526-36963548 CCTTTTGCTTAGTGATTTGGGGG + Intergenic
972565655 4:40266845-40266867 CCCTTGGCTTTGTGATTTTGGGG + Intergenic
973193583 4:47414569-47414591 CCTTTAGCTTAGTGATTTGGGGG + Intronic
973246185 4:48013681-48013703 CCTTTAGCTTAGTGATTTGGGGG + Intronic
973911672 4:55588106-55588128 CCCTTGGCTTAGTGATTTGGGGG - Intronic
974082826 4:57230583-57230605 CCCTTGGCTTAGTGATTTTGGGG + Intergenic
974628807 4:64457331-64457353 CTATTGAGTTGGTGATGTGGGGG + Intergenic
974935385 4:68404758-68404780 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
975051664 4:69872847-69872869 CCTTTAGTTTAGTGATTTTGGGG - Intergenic
975251286 4:72181150-72181172 TCATTGGTTTAGTGACTGGGTGG - Intergenic
975310697 4:72900082-72900104 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
975573024 4:75837094-75837116 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
977349033 4:95856897-95856919 CCCTTGGCTTAGTGATTTTGGGG + Intergenic
977719535 4:100223689-100223711 TCATTGGTTTGGTGAGCTGTGGG + Intergenic
977720716 4:100236937-100236959 CCCTTGGTTTAGTAATTTTGGGG + Intergenic
978163747 4:105581243-105581265 CCAGTGTTTTGGTCACTTGGTGG + Intronic
978598647 4:110405254-110405276 CCCTTGGCTTAGTGATTTTGGGG - Intronic
980270294 4:130575125-130575147 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
980927660 4:139154478-139154500 CTTTTGGCTTAGTGATTTGGAGG - Intronic
980983657 4:139674868-139674890 CCTTTGGCTTAGTGATTTGGGGG + Intronic
980984012 4:139677979-139678001 CCCTTGGCTTAGTGATTTTGGGG + Intronic
981092963 4:140752146-140752168 CCATTGGATGGTTCATTTGGGGG - Intronic
981523272 4:145687053-145687075 CCTTTAGCTTAGTGATTTGGGGG - Intronic
981831285 4:149005037-149005059 CCCTTGGCTTAGTGATTTGAGGG + Intergenic
982197329 4:152929528-152929550 TCTTTGGCTTAGTGATTTGGGGG + Intergenic
983053976 4:163080724-163080746 CCCTTGGCTTAGTGATTTAGGGG - Intergenic
983583695 4:169334180-169334202 CCCTTGGCTTAGTGATTTTGGGG - Intergenic
983804818 4:171981568-171981590 GCCTTGGCTTAGTGATTTGGGGG + Intronic
984031163 4:174605871-174605893 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
984156052 4:176197310-176197332 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
984399146 4:179239159-179239181 CCTTTGATTTAGTGATTTGGGGG + Intergenic
984730297 4:183062116-183062138 CCATTGTTTTGGCTATTTGGAGG + Intergenic
986288763 5:6380830-6380852 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
986505476 5:8445603-8445625 CATTTGGCTTAGTGATTTGGGGG + Intergenic
986637019 5:9833346-9833368 CCCTTGGCTTAGTGATTTTGGGG + Intergenic
988185728 5:27859134-27859156 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
988353062 5:30137472-30137494 CTATTAGTTTTGTGATTTGATGG + Intergenic
988388206 5:30593849-30593871 CCTTTGGGTTAGTGATTTGAGGG + Intergenic
989184024 5:38605551-38605573 CCTTTGGCTTTGTGATTTGGGGG - Intronic
989204679 5:38798780-38798802 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
989319659 5:40120226-40120248 CCCTTGGCTTAGTGATTTTGAGG - Intergenic
989575862 5:42987469-42987491 CTTTTGGCTTAGTGATTTGGGGG + Intergenic
990115169 5:52380932-52380954 CCTTTGGTTTAGTCATTTGGGGG - Intergenic
991043271 5:62196898-62196920 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
991208334 5:64075717-64075739 TCATTGGTTTGTTGATTGGTTGG + Intergenic
991244121 5:64490608-64490630 TCATTGCTGTGGTTATTTGGAGG - Intergenic
992446543 5:76839335-76839357 CCATTAGCTTAGTGATTTTGGGG - Intergenic
993346231 5:86786644-86786666 CCAAAGGCTTGGTGATTTAGTGG + Intergenic
993689445 5:90981404-90981426 CCTTTAGCTTAGTGATTTGGGGG + Intronic
993733004 5:91445050-91445072 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
996031337 5:118707704-118707726 CCATTGCTTTTGTGATTTAATGG - Intergenic
997392928 5:133531726-133531748 CCACAGGTTTGGTGATAGGGCGG + Intronic
999358282 5:150957684-150957706 CCTTTAGCTTGGTGATTTTGGGG - Intergenic
999414934 5:151386888-151386910 ACATTGGTTAGGTTCTTTGGAGG - Intergenic
1004041703 6:11985552-11985574 CCCTTGGTTTGGTTCTCTGGCGG + Intergenic
1004332191 6:14732094-14732116 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
1004416993 6:15433741-15433763 CCATTCTTTTGGGGATATGGGGG + Intronic
1004481078 6:16019778-16019800 CCTTTGGCTTCGTGATTTGGGGG - Intergenic
1004646040 6:17561533-17561555 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1005300709 6:24467797-24467819 CCTTTAGTTTAGTGATTTTGGGG - Intronic
1005313795 6:24585239-24585261 CCTTTGGCTTAGTGATTTGGGGG - Intronic
1005371246 6:25136100-25136122 CCTTTAGTTTAGTGATTTGAGGG - Intergenic
1005615437 6:27568093-27568115 CCCTTGGTTTAGTGATTTTGGGG - Intergenic
1006271961 6:32971904-32971926 CAATTGGCTTGGAGATGTGGCGG + Exonic
1006965707 6:37982296-37982318 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1007400944 6:41601930-41601952 CCAGCAGTTTGGTGATTTGTGGG - Exonic
1007818791 6:44544599-44544621 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1007884423 6:45210145-45210167 CCTTTGGCTTAGTGATTTTGGGG - Intronic
1008650344 6:53555014-53555036 CCCTTGGCTTAGTGCTTTGGAGG - Intronic
1009361881 6:62825043-62825065 CCTTTCGCTTAGTGATTTGGGGG - Intergenic
1009823578 6:68837711-68837733 AAATTGGTTTGTTGATCTGGAGG + Intronic
1010496130 6:76535530-76535552 CCCTTAGCTTAGTGATTTGGGGG + Intergenic
1010564265 6:77390379-77390401 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1011134704 6:84087439-84087461 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1012166705 6:95963037-95963059 CCTTTGCCTTAGTGATTTGGGGG + Intergenic
1012211199 6:96521027-96521049 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1013409285 6:109869714-109869736 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1014110146 6:117611882-117611904 CCTTTAGTTTAGTGATTTTGGGG - Intergenic
1014182827 6:118404224-118404246 CTGTTGGTTTGCTAATTTGGTGG + Intergenic
1014431576 6:121376920-121376942 CCATTGGCTCAGTGATTTGGAGG + Intergenic
1014434417 6:121405632-121405654 CCCTTGGCTTAGTGATTTCGGGG - Intergenic
1014455697 6:121632202-121632224 CCTTTAGCTTTGTGATTTGGGGG + Intergenic
1014703311 6:124715787-124715809 CCTTTGGTTTGGGTATATGGAGG - Intronic
1014930800 6:127333321-127333343 CCCTTGGCTTAGTGATTTTGGGG + Intronic
1016048604 6:139506149-139506171 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1016731619 6:147433427-147433449 CCTTTGGTTTGGGGATTTCGAGG - Intergenic
1017348281 6:153409600-153409622 CCTTTGGTTTAGTGATTTTGGGG + Intergenic
1017386087 6:153885339-153885361 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1017661673 6:156680065-156680087 ACAATGGTTTGGTGACTAGGTGG - Intergenic
1018601884 6:165552773-165552795 CCCTCAGTTTGGTGATTTGCTGG - Intronic
1019099792 6:169620230-169620252 CCCTTGGCTTAGTGATTTGGGGG - Intronic
1019099924 6:169621947-169621969 CCTTTAGCTTGGTGATTTGGGGG - Intronic
1019233338 6:170586758-170586780 CCTTTGGTTTAGTGATTTTGTGG + Intergenic
1019252905 7:29311-29333 CCCTTGGCTTAGTGATTTGGGGG - Intergenic
1019491939 7:1318299-1318321 GCGTTGGTTTTGTAATTTGGAGG + Intergenic
1019822960 7:3259655-3259677 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1020024641 7:4890443-4890465 CCTTTGGTTTAGTGATTTTGGGG - Intergenic
1020340924 7:7110272-7110294 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1020861400 7:13496482-13496504 CCATTGCTGGGCTGATTTGGGGG - Intergenic
1021147431 7:17106436-17106458 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1021802079 7:24317094-24317116 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1023216368 7:37867381-37867403 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1023278800 7:38548447-38548469 CCCTTGGCTTAGTGATTTTGGGG + Intronic
1023300043 7:38760301-38760323 CCTTTGGCTTAGTGAATTGGAGG - Intronic
1023736042 7:43236928-43236950 CCCTTGGCTTAGTGATTTGGGGG + Intronic
1024008512 7:45245798-45245820 CCATTATTTTGTTGATTTGTGGG - Intergenic
1024013411 7:45290284-45290306 CCTTTAGCTTGTTGATTTGGGGG - Intergenic
1024547665 7:50535983-50536005 CCTTTGGCTTAGTGATTTGGGGG - Intronic
1024573744 7:50747334-50747356 CCTTTGTTTTGTGGATTTGGAGG - Intronic
1024828971 7:53425869-53425891 CCTTTGGCTCAGTGATTTGGGGG + Intergenic
1025003114 7:55334663-55334685 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1025849268 7:65232604-65232626 CCATTGGCTTAGTGATTTGGGGG + Intergenic
1025962561 7:66236160-66236182 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1026142521 7:67718436-67718458 CCATTAGCTTACTGATTTGGGGG - Intergenic
1026346721 7:69480848-69480870 CCTTTAGCTTGGTGATTTTGGGG + Intergenic
1027675626 7:81154450-81154472 CCTTCGGCTTGGTGATTTTGGGG - Intergenic
1030236762 7:107272139-107272161 CCTTTAGCTTAGTGATTTGGGGG - Intronic
1031197946 7:118640497-118640519 CCCTTGGCTTAGTGATTTGGGGG - Intergenic
1031453337 7:121949332-121949354 CCTTTAGTTTAGTGATTTGGGGG + Intronic
1031622153 7:123947000-123947022 CCCTTGGCTTAGTGATTTTGTGG + Intronic
1031625880 7:123992279-123992301 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1032144540 7:129367162-129367184 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1032607434 7:133370685-133370707 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1032664828 7:134025590-134025612 TCATCTGTCTGGTGATTTGGTGG + Intronic
1033627130 7:143121358-143121380 CCTTTGGCTTAGTGATTTTGTGG + Intergenic
1034143479 7:148846389-148846411 ACATTTGTTTGGTTATTGGGAGG - Intronic
1034240209 7:149604521-149604543 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1036008497 8:4694003-4694025 CCTTTGGCTTAGTGATTTGGGGG - Intronic
1036146188 8:6257069-6257091 CCCTTGGCTTAGTGATTTGGGGG + Intergenic
1036218626 8:6901973-6901995 CCCTTGGCTTAGTGATTTGGTGG + Intergenic
1036385009 8:8271114-8271136 CCATTTCTTGTGTGATTTGGGGG + Intergenic
1037142323 8:15534120-15534142 CCTTTGGTTTAGTGAGTTTGGGG + Intronic
1037403459 8:18517121-18517143 ACTTTGGCTTAGTGATTTGGTGG - Intergenic
1037707838 8:21330660-21330682 CCTTTGGCTTAGTGATTTGGGGG + Intergenic
1038009682 8:23465135-23465157 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1038077529 8:24093451-24093473 AGATTGGTTTGATTATTTGGGGG - Intergenic
1038400273 8:27279326-27279348 CCTTTAGCTTGGTGGTTTGGGGG + Intergenic
1038674207 8:29608730-29608752 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1039244800 8:35596888-35596910 CCTTTAGCTTAGTGATTTGGGGG + Intronic
1039373789 8:37013258-37013280 CCTTTAGTTTAGTGATTTTGGGG - Intergenic
1039690190 8:39855436-39855458 CCTTTGGCTTAGTGATTTGGGGG + Intergenic
1039799268 8:40940184-40940206 CCATTTGTTTGGTGACTGTGAGG - Intergenic
1039955585 8:42204932-42204954 CCTTTGGCTTAGTGATTTGGGGG - Intronic
1040685238 8:49863975-49863997 CCCTTGGTTTAGTGATTTGAAGG - Intergenic
1040913546 8:52545147-52545169 CCCTTGGCTTAGTGATTTTGGGG - Intronic
1040931624 8:52741238-52741260 CCATTGGTTGGGTGAGTTAAAGG - Intronic
1040997826 8:53419693-53419715 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1041371544 8:57165885-57165907 CCTTTAGCTTGGTGATTTAGGGG + Intergenic
1041390299 8:57341751-57341773 CCTTTGGCTTAGTGATTTCGGGG - Intergenic
1041479017 8:58297564-58297586 TCCTTGGCTTTGTGATTTGGGGG - Intergenic
1042184368 8:66122166-66122188 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1043360179 8:79462857-79462879 CCACTGATTTCCTGATTTGGTGG + Intergenic
1043570240 8:81594843-81594865 CCTTTGGCTTAGTGATTTAGTGG - Intergenic
1044685882 8:94824805-94824827 CTATTGGTTTGGTTTTTTTGGGG - Intronic
1044952675 8:97449301-97449323 GCTTGTGTTTGGTGATTTGGGGG - Intergenic
1045559517 8:103247506-103247528 TAATTGGTTGTGTGATTTGGGGG + Intergenic
1046279660 8:112009292-112009314 CCGTTGGTTTGGTGATTCCATGG - Intergenic
1047110953 8:121789131-121789153 CTCTTGGCTTAGTGATTTGGGGG - Intergenic
1047136119 8:122080205-122080227 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1047794343 8:128238955-128238977 CCAATGGGATGGTTATTTGGAGG + Intergenic
1048407869 8:134141374-134141396 GCTTTGGTTGGGTGATTTTGTGG + Intergenic
1048494458 8:134923578-134923600 CCATTAGCTTAGTGATCTGGGGG - Intergenic
1048520168 8:135146418-135146440 CCGTTAGCTTGGTGATTTGGGGG + Intergenic
1050989927 9:12137685-12137707 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1050990441 9:12144595-12144617 CCTTTAGCTTGGTGATTTTGGGG - Intergenic
1051629885 9:19131300-19131322 CCTTTGGTTCAGTGATTTTGGGG - Intronic
1053017167 9:34668591-34668613 CCCTTGGTTGAATGATTTGGGGG - Intergenic
1053060612 9:35028279-35028301 CCCTTGGATTAGTGATTTTGAGG + Intergenic
1053099274 9:35356497-35356519 CCATTAGTTTGGCAATATGGTGG - Intronic
1053725966 9:41001267-41001289 CCATTGGTTTCGTGTGTTTGTGG + Intergenic
1053749387 9:41236779-41236801 CGATTGGTTGGTTGCTTTGGGGG + Intergenic
1053803230 9:41777215-41777237 CCCTTGGCTTGGTAATTTTGGGG + Intergenic
1054142032 9:61537909-61537931 CCCTTGGCTTGGTAATTTTGGGG - Intergenic
1054191523 9:61988525-61988547 CCCTTGGCTTGGTAATTTTGGGG + Intergenic
1054461793 9:65469087-65469109 CCCTTGGCTTGGTAATTTTGGGG - Intergenic
1054646847 9:67599187-67599209 CCCTTGGCTTGGTAATTTTGGGG - Intergenic
1055054489 9:72011197-72011219 CCTTTGGCTTAGTGATTTGGGGG + Intergenic
1055117922 9:72625363-72625385 GCTTTGGTTGGGTGATTTGGGGG + Intronic
1055188055 9:73480295-73480317 CCTTTAGTTTAGTGATTTTGGGG + Intergenic
1056422038 9:86438063-86438085 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1056774156 9:89498873-89498895 CCATGGGTTTGGGGATCTGGGGG + Intergenic
1056840882 9:89997217-89997239 CCCTTTGTTTGGGGATTTTGTGG + Intergenic
1057238784 9:93390450-93390472 TCTTTGTTTTGGTGGTTTGGGGG + Intergenic
1057574911 9:96234589-96234611 CCATTGGCTTAGGGATTTTGGGG - Intergenic
1057909589 9:99007363-99007385 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1058131608 9:101260030-101260052 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1059350477 9:113660756-113660778 TCATTGAATTGGTGATTTGGAGG + Intergenic
1059386709 9:113970363-113970385 CCATTTGTTGGGTGGATTGGAGG + Intronic
1059888193 9:118769983-118770005 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1060236313 9:121865575-121865597 CCATTGGATTACTGATTTGGGGG - Intronic
1062259259 9:135651643-135651665 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1062558556 9:137128795-137128817 CCTGTAGTTGGGTGATTTGGGGG + Intergenic
1062747465 9:138223063-138223085 CCCTTGGCTTAGTGATTTGGGGG + Intergenic
1185804918 X:3048216-3048238 CCCTTGGCTTAGTGATTTTGGGG - Intronic
1185852261 X:3500144-3500166 CCGTTAGCTTAGTGATTTGGGGG + Intergenic
1185917231 X:4048787-4048809 CCATTGGCTTAGTGATTTGAGGG + Intergenic
1185920755 X:4089518-4089540 CCACTGGTTGTGTGATTTGCTGG + Intergenic
1186007893 X:5094556-5094578 CCTTTAGCTTAGTGATTTGGAGG + Intergenic
1186029327 X:5349642-5349664 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1186034333 X:5404527-5404549 CCCTTGGCTTGGTGATTTGGGGG + Intergenic
1186046416 X:5541536-5541558 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1186863571 X:13696662-13696684 CCATTGGATTGGCCATTAGGAGG + Intronic
1186871830 X:13781322-13781344 CCTTTGGCTTAGTGATTTGGGGG - Intronic
1187139864 X:16583269-16583291 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1187626348 X:21118371-21118393 CTATTGGTTTGGTAAATAGGAGG + Intergenic
1187687991 X:21835266-21835288 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
1187817378 X:23247428-23247450 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1187888257 X:23908919-23908941 GCTTTGGTTCGGTGATTTTGGGG + Intronic
1188255350 X:27955929-27955951 CCTTTAGTTTAGTGATTTGGGGG - Intergenic
1188285653 X:28322888-28322910 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1188491382 X:30741962-30741984 CCCTTGGTTTAGCGATTTGGGGG + Intergenic
1188554899 X:31400138-31400160 CCTTTAGTTTGGTGATTTTGAGG - Intronic
1189656873 X:43253731-43253753 GCTTTGGTTGGATGATTTGGAGG + Intergenic
1190117392 X:47635638-47635660 CCTGGGGGTTGGTGATTTGGGGG - Exonic
1190868195 X:54402365-54402387 ACTTTGGTTTGGTGATTTGGAGG + Intergenic
1191618374 X:63190829-63190851 TTATTGGCTTAGTGATTTGGGGG + Intergenic
1191842274 X:65521803-65521825 CCACTGATTTGGTAATTAGGAGG + Intronic
1192466230 X:71358401-71358423 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1193179616 X:78439505-78439527 TTCTTGGCTTGGTGATTTGGGGG - Intergenic
1193266088 X:79471584-79471606 CCTTTGGCTTAGTGATTTAGGGG - Intergenic
1193318644 X:80094664-80094686 CCTTTGGCTTAGTGATTTTGAGG - Intergenic
1193319681 X:80106752-80106774 TCCTTGGTTTAGTGATTTTGGGG - Intergenic
1193639995 X:84001229-84001251 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1193673262 X:84416187-84416209 GCCTTGGTTGGGTGATTTAGGGG - Intronic
1193760868 X:85463340-85463362 CCATTGGTTTGGAGAAAGGGAGG + Intergenic
1193809801 X:86038071-86038093 CTTTTGGTTTAGTGATTTTGGGG - Intronic
1193936333 X:87626739-87626761 CTTTTGGCTTAGTGATTTGGGGG + Intronic
1194234323 X:91363085-91363107 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1194247213 X:91530155-91530177 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1194451641 X:94050896-94050918 CCATTAGTTTAGTGATTTTGGGG + Intergenic
1194492613 X:94569916-94569938 TCTTTGGCTTAGTGATTTGGGGG + Intergenic
1194585809 X:95732912-95732934 CCATTGAATAGGTGATTTGATGG + Intergenic
1194594335 X:95838326-95838348 CCTTTAGTTTAGTGATTTGGTGG + Intergenic
1194810838 X:98385031-98385053 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1194829693 X:98607060-98607082 GCATTGCATTGGTAATTTGGAGG - Intergenic
1195203084 X:102567970-102567992 CCAATGGTGTGGTAATGTGGTGG + Intergenic
1195286384 X:103388737-103388759 CCTTTAGCTTGGTGACTTGGGGG - Intergenic
1195401186 X:104463225-104463247 CCTTTGGCTTAGTGATTTGGAGG - Intergenic
1195540104 X:106054017-106054039 CCTTTAGCTTAGTGATTTGGGGG - Intergenic
1195647793 X:107252373-107252395 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
1196266010 X:113647246-113647268 CCTTTGCTTTAGTAATTTGGTGG + Intergenic
1196651740 X:118174905-118174927 CCAGTGGTTTGGCAATATGGAGG + Intergenic
1196884239 X:120227791-120227813 CCTTTGGCTTAGTGATTTGGGGG - Intergenic
1196884909 X:120235215-120235237 CCTTTGGCTTAGTGATTTTGGGG - Intergenic
1197129621 X:122990155-122990177 GCTTTGGTTAGGTGATATGGGGG - Intergenic
1197376448 X:125687555-125687577 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1197500780 X:127239674-127239696 CCATTAGGTTGGTGCTTTGAGGG - Intergenic
1197565368 X:128077574-128077596 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1197945351 X:131832472-131832494 CCTTTGGCTTAGTGATTTTGGGG + Intergenic
1198130023 X:133684437-133684459 CCACTGTTGTGGTGATTTGAGGG - Intronic
1198862553 X:141086977-141086999 CCTTTAGTGTAGTGATTTGGGGG - Intergenic
1198900141 X:141500409-141500431 CCTTTAGTGTAGTGATTTGGGGG + Intergenic
1199746869 X:150777362-150777384 CCCTTGGCTTAGTGATTTTGGGG + Intronic
1200285054 X:154813000-154813022 CCTTTGGCTTAGTGATTTTGGGG + Intronic
1200285890 X:154821920-154821942 CCTTTCGCTTGGTCATTTGGGGG + Intergenic
1200389135 X:155925839-155925861 CCTTTAGCTTAGTGATTTGGAGG + Intronic
1200566233 Y:4771693-4771715 CCTTTAGCTTAGTGATTTGGGGG + Intergenic
1201319337 Y:12680889-12680911 CCATTAGTTTAGTGATTTGGGGG - Intergenic
1201638043 Y:16147175-16147197 CCCTTGGCCTGGTGATTTTGGGG - Intergenic
1201914548 Y:19168230-19168252 CCTTTAGTTTAGTGATTTGAGGG - Intergenic