ID: 1148238143

View in Genome Browser
Species Human (GRCh38)
Location 17:45983066-45983088
Sequence GGCTCCTGAGGGCCTCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 8, 3: 36, 4: 255}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148238143_1148238148 -9 Left 1148238143 17:45983066-45983088 CCAACAGGAGGCCCTCAGGAGCC 0: 1
1: 0
2: 8
3: 36
4: 255
Right 1148238148 17:45983080-45983102 TCAGGAGCCCTCCCTGGAGTGGG 0: 1
1: 0
2: 1
3: 30
4: 270
1148238143_1148238158 11 Left 1148238143 17:45983066-45983088 CCAACAGGAGGCCCTCAGGAGCC 0: 1
1: 0
2: 8
3: 36
4: 255
Right 1148238158 17:45983100-45983122 GGGGACAAAAAGGCGGGGACTGG 0: 1
1: 0
2: 0
3: 21
4: 231
1148238143_1148238155 4 Left 1148238143 17:45983066-45983088 CCAACAGGAGGCCCTCAGGAGCC 0: 1
1: 0
2: 8
3: 36
4: 255
Right 1148238155 17:45983093-45983115 CTGGAGTGGGGACAAAAAGGCGG 0: 1
1: 0
2: 2
3: 45
4: 360
1148238143_1148238149 -8 Left 1148238143 17:45983066-45983088 CCAACAGGAGGCCCTCAGGAGCC 0: 1
1: 0
2: 8
3: 36
4: 255
Right 1148238149 17:45983081-45983103 CAGGAGCCCTCCCTGGAGTGGGG 0: 1
1: 1
2: 1
3: 36
4: 300
1148238143_1148238162 27 Left 1148238143 17:45983066-45983088 CCAACAGGAGGCCCTCAGGAGCC 0: 1
1: 0
2: 8
3: 36
4: 255
Right 1148238162 17:45983116-45983138 GGACTGGGCCGAGAAGGGTCCGG 0: 1
1: 0
2: 4
3: 22
4: 219
1148238143_1148238147 -10 Left 1148238143 17:45983066-45983088 CCAACAGGAGGCCCTCAGGAGCC 0: 1
1: 0
2: 8
3: 36
4: 255
Right 1148238147 17:45983079-45983101 CTCAGGAGCCCTCCCTGGAGTGG 0: 1
1: 0
2: 2
3: 30
4: 335
1148238143_1148238161 22 Left 1148238143 17:45983066-45983088 CCAACAGGAGGCCCTCAGGAGCC 0: 1
1: 0
2: 8
3: 36
4: 255
Right 1148238161 17:45983111-45983133 GGCGGGGACTGGGCCGAGAAGGG 0: 1
1: 0
2: 2
3: 26
4: 310
1148238143_1148238152 1 Left 1148238143 17:45983066-45983088 CCAACAGGAGGCCCTCAGGAGCC 0: 1
1: 0
2: 8
3: 36
4: 255
Right 1148238152 17:45983090-45983112 TCCCTGGAGTGGGGACAAAAAGG 0: 1
1: 0
2: 2
3: 25
4: 273
1148238143_1148238157 6 Left 1148238143 17:45983066-45983088 CCAACAGGAGGCCCTCAGGAGCC 0: 1
1: 0
2: 8
3: 36
4: 255
Right 1148238157 17:45983095-45983117 GGAGTGGGGACAAAAAGGCGGGG 0: 1
1: 0
2: 6
3: 59
4: 457
1148238143_1148238156 5 Left 1148238143 17:45983066-45983088 CCAACAGGAGGCCCTCAGGAGCC 0: 1
1: 0
2: 8
3: 36
4: 255
Right 1148238156 17:45983094-45983116 TGGAGTGGGGACAAAAAGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 409
1148238143_1148238160 21 Left 1148238143 17:45983066-45983088 CCAACAGGAGGCCCTCAGGAGCC 0: 1
1: 0
2: 8
3: 36
4: 255
Right 1148238160 17:45983110-45983132 AGGCGGGGACTGGGCCGAGAAGG 0: 1
1: 0
2: 2
3: 21
4: 283
1148238143_1148238159 12 Left 1148238143 17:45983066-45983088 CCAACAGGAGGCCCTCAGGAGCC 0: 1
1: 0
2: 8
3: 36
4: 255
Right 1148238159 17:45983101-45983123 GGGACAAAAAGGCGGGGACTGGG 0: 1
1: 0
2: 0
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148238143 Original CRISPR GGCTCCTGAGGGCCTCCTGT TGG (reversed) Intronic
900032287 1:380634-380656 GGGTCCTGAGGGCCACCCTTCGG + Intergenic
900052837 1:608820-608842 GGGTCCTGAGGGCCACCCTTCGG + Intergenic
900086645 1:901502-901524 GGCTTCTCAAGGCCTCCTCTGGG - Intergenic
902371806 1:16012390-16012412 GGCTCTGGAGGGCTTCCTGGAGG + Intergenic
903193200 1:21668187-21668209 GCCTCCTGAGAGCCTCATATGGG + Intronic
904627695 1:31816139-31816161 TCCTCCTGAGGGCTTCCTGGAGG + Intergenic
905125118 1:35710745-35710767 GGCTCCTCAGGGCCTCATGCAGG + Intergenic
905371172 1:37483381-37483403 GGCTCCTGAAGGACTGATGTGGG - Exonic
906236920 1:44217606-44217628 GGTTCCTTGGGGCCTCCAGTAGG + Intronic
908231528 1:62110335-62110357 GTCTTCTCAAGGCCTCCTGTGGG - Intronic
908456838 1:64312472-64312494 GGCTTCTGAGGTCCTCCTGGGGG + Intergenic
908558799 1:65284546-65284568 GTCTCCTCAAGGCCTCCAGTGGG + Intronic
909021315 1:70434371-70434393 GGCCCCTGAGAGCCTCCTCCTGG - Intronic
911150970 1:94596562-94596584 TTGTCCTGAGGGCCTCCTGCAGG - Intergenic
913536673 1:119779551-119779573 GGCCCCCGAAGGCCTCCTGGGGG - Intergenic
916802977 1:168231747-168231769 GACTCCTCAGGGCTTCCTCTGGG + Intronic
917682143 1:177378078-177378100 GCCTGCAGATGGCCTCCTGTGGG + Intergenic
918261991 1:182804716-182804738 GGCTCTGGAGGGGCTCCTGTTGG - Intronic
920179466 1:204123551-204123573 GCCTCCTCAGTGCCTCCTGCTGG + Intronic
920340070 1:205270013-205270035 GGCTCCTTAGGGCCTCGTGCTGG - Intronic
923046824 1:230361862-230361884 GGATCCTGAAGGCTTCCTGGAGG + Intronic
923701437 1:236303750-236303772 GGGTGCTGAGGGGCTGCTGTTGG - Intergenic
1063141161 10:3257754-3257776 GGCCAGGGAGGGCCTCCTGTGGG - Intergenic
1063171453 10:3513525-3513547 AGCTGCTGAGGGCTTCCTGTAGG - Intergenic
1063309665 10:4940410-4940432 GACTTCTGAGAGCCTGCTGTTGG - Intronic
1063317626 10:5021691-5021713 GACTTCTGAGAGCCTGCTGTTGG + Intronic
1064122954 10:12635170-12635192 GGCTCGGGAGGCCTTCCTGTGGG + Intronic
1065847790 10:29760721-29760743 AGCTCCTGAGGGCCTCATCCTGG - Intergenic
1066647194 10:37622003-37622025 GGCTTCTGAGGCCCTCCTCCAGG - Intergenic
1069930979 10:71881337-71881359 GGTTCCTGAAGGCCTTCTGTGGG - Intergenic
1071523060 10:86342657-86342679 GGCTCCCTAGGGCTTCCTGGAGG - Intronic
1072631720 10:97151200-97151222 AGTTCCTGAGGGCCTCCTGTGGG - Intronic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1073338188 10:102726413-102726435 GTTTCCTGAGGGCCTGCTGGTGG - Intronic
1074055135 10:109916413-109916435 GGCACCAGGGGGCCTACTGTGGG + Intronic
1076344116 10:129768835-129768857 GGCTGCAGAGGGCGGCCTGTAGG - Intergenic
1076904569 10:133355653-133355675 AGCTCCTGAGGCCCCCCGGTGGG + Intronic
1077027714 11:448606-448628 GGCTCCAGGGGGCGTGCTGTTGG - Intronic
1077538459 11:3135457-3135479 CACTCCTGAGGCCCTCCTCTGGG + Intronic
1077798868 11:5518471-5518493 AGCCCCAGAGGGCCTCCTGGTGG + Intronic
1078423994 11:11234518-11234540 GACTCCTCAGAGCCACCTGTGGG - Intergenic
1078642968 11:13113563-13113585 GTCCCCTTGGGGCCTCCTGTCGG + Intergenic
1083268052 11:61556077-61556099 GGCTCCTGAGGGCCCCTTGGAGG - Intronic
1083757409 11:64799164-64799186 GGCACATGACGGCCTCCTTTTGG + Intronic
1084472392 11:69370685-69370707 GGCTCCTGACAGTTTCCTGTGGG + Intergenic
1084672646 11:70616347-70616369 GGCTGGGGAGGGCCTCCTCTTGG - Intronic
1086027504 11:82312336-82312358 GGCACCTGAGGTCCTTCTGTTGG - Intergenic
1088641699 11:111879108-111879130 GGCCCCTCGGCGCCTCCTGTTGG - Exonic
1089177318 11:116558147-116558169 TGTCCCTGAGTGCCTCCTGTGGG - Intergenic
1090416175 11:126542008-126542030 GGGTCCTGAGGGCCCGCTGCAGG - Intronic
1091281602 11:134384666-134384688 GGCTCCTGCGGGCCCACAGTGGG - Intronic
1097876249 12:64646842-64646864 GGTTACTGAGGGCCTCCTCTGGG + Intronic
1098171725 12:67753674-67753696 TGCTGCTGCGGGCTTCCTGTGGG - Intergenic
1101759328 12:107645973-107645995 GGCCCCTGGGAGCCTCCTGCTGG - Intronic
1103736531 12:123064378-123064400 GGTGGCTGAGAGCCTCCTGTGGG - Intronic
1105279364 13:18954303-18954325 GACTCAGGAGGGCCTCCTGTAGG - Intergenic
1105624881 13:22103183-22103205 GCCTCATGAGGGCCCCCTGCTGG + Intergenic
1107781874 13:43912269-43912291 GGTTCCTGTGGGTCGCCTGTGGG + Intergenic
1109092986 13:58072199-58072221 GGCTCCAGAGGGCCACCTCCAGG - Intergenic
1112504688 13:99968846-99968868 GGCTCCTGCGGGCCGCCTGATGG - Intronic
1113707225 13:112442718-112442740 GGCTCCTGAGCACTTCCAGTAGG + Intergenic
1113775017 13:112939232-112939254 GGCATCTGAGGGCCTCCGGCAGG + Intronic
1114417422 14:22554115-22554137 GGCTCCCACGGGCCTCCTGCAGG - Intergenic
1117336469 14:54760552-54760574 GGCTCCTGGGGGCTTCCCCTGGG + Intronic
1118728530 14:68649984-68650006 GGCTCCTGAGAGCCACCTCTTGG + Intronic
1119395770 14:74325216-74325238 AGCTCCTGTGGGCCATCTGTGGG + Intronic
1121236522 14:92395213-92395235 GGCACCTGAGCCCCTACTGTGGG - Intronic
1121629127 14:95409822-95409844 GGGTGATGAGGGCCACCTGTGGG + Intronic
1122736815 14:103847931-103847953 GGCTCCCGGGGGCCGACTGTGGG + Intergenic
1122901730 14:104784821-104784843 GGCCCCTGAGGGCCAGCTGGTGG + Intronic
1123132392 14:105999418-105999440 GGTTCCTGAGTGCCCCCTGGTGG + Intergenic
1123132659 14:106000479-106000501 GTGTCCTGAGTGCCTCCTGGTGG + Intergenic
1123164057 14:106309001-106309023 TGGTCCTGAGCGCCCCCTGTTGG + Intergenic
1123204050 14:106694806-106694828 GTGTCCTGAGGTCCTCCTGGTGG + Intergenic
1123218152 14:106831426-106831448 GGTTCCTGAGTGCCCCCTGGTGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1123582638 15:21730650-21730672 GGTTCCTGAGCGCCCCCTGGTGG + Intergenic
1123582803 15:21731318-21731340 GGTTCCTTAGGGCCCCCTGGTGG + Intergenic
1123582867 15:21731571-21731593 GTGTCCTGAGCGCCTCCTGGTGG + Intergenic
1123619288 15:22173246-22173268 GGTTCCTGAGCGCCCCCTGGTGG + Intergenic
1123619453 15:22173914-22173936 GGTTCCTTAGGGCCCCCTGGTGG + Intergenic
1123619517 15:22174167-22174189 GTGTCCTGAGCGCCTCCTGGTGG + Intergenic
1125513232 15:40303857-40303879 GGCTCCAGAGGCTCCCCTGTAGG - Intronic
1125681679 15:41534741-41534763 GGCTCCTGAGGAGATCCTGCAGG - Exonic
1126335607 15:47583514-47583536 GGCTCCTGGAGACCGCCTGTTGG - Intronic
1127643264 15:60935065-60935087 ATTTCCTGAGGGCCCCCTGTGGG - Intronic
1127662803 15:61115848-61115870 AGCTCCAGAGGGCTTCCTTTAGG + Intronic
1128084795 15:64878350-64878372 GCTTCCTGAGGGCCTCCCGTGGG - Intronic
1129737355 15:77973772-77973794 GGCTCCTGCGGGCCTGCTGTTGG - Intergenic
1129757714 15:78108604-78108626 GGCTCCAGAGGCCCCCCTGCAGG + Intronic
1129848717 15:78779853-78779875 GGCTCCTGCGGGCCTGCTGTTGG + Intronic
1129951148 15:79592628-79592650 GGCTTCTGAGGGCCTCCAGAAGG + Intergenic
1130253203 15:82314093-82314115 GGCTCCTGCAGGCCTGCTGCTGG - Intergenic
1130649782 15:85756020-85756042 GGCCCCTGAGGGCTTGCAGTAGG - Intergenic
1131155774 15:90074330-90074352 GGCTCCTGAGTGCGTCATGTTGG - Intronic
1131479650 15:92769898-92769920 GGTTCCTGGGGGCCTACTCTTGG + Intronic
1132339714 15:101070413-101070435 GACTCCTGAGACCCTGCTGTGGG - Intronic
1132544201 16:525847-525869 GCCTCCTGAGGCCCTCTTCTGGG + Intergenic
1132606220 16:794826-794848 GGTTCCTGGAGGCCTCCTGGTGG + Intronic
1132895653 16:2228257-2228279 TGCTTCTGATGGCCTCCTGGGGG + Intronic
1132981420 16:2740265-2740287 GGGTGCTGAGGACCTGCTGTAGG + Intergenic
1133748000 16:8701975-8701997 GGGTCCTGCAGGCCTCCTGGAGG + Intronic
1134098290 16:11434101-11434123 GGCTCGGGAGGGCTTCCTGGAGG - Intronic
1135198958 16:20420135-20420157 GGCCCCTGAGAGGCTCCTTTTGG - Intronic
1135219732 16:20603537-20603559 GGCCCCTGAGAGGCTCCTTTTGG + Intergenic
1135436314 16:22428931-22428953 AGCTCCTGGTGGCCTCCTGCTGG + Intronic
1136073501 16:27802998-27803020 GGCTCGTGAGGGCCTCCAGGAGG - Intronic
1136221650 16:28833239-28833261 GGCCCCTCAGTGCCTCCTGATGG - Exonic
1136692104 16:32039701-32039723 GGGTCCTGAGGGCCCCCTCGTGG - Intergenic
1136792647 16:32983139-32983161 GGGTCCTGAGGGCCCCCTCGTGG - Intergenic
1136877209 16:33870915-33870937 GGGTCCTGAGGGCCCCCTCGTGG + Intergenic
1137436134 16:48455582-48455604 GGCTCCAGGGGGCTTCCTGGAGG + Intergenic
1139348809 16:66322612-66322634 GCCTCCTGTGGCTCTCCTGTGGG - Intergenic
1142045529 16:87922765-87922787 AGCTCCTGATGGCCTCCTGCTGG + Intronic
1142282100 16:89154023-89154045 GGCGCCTGAGTTCCTCCTGCTGG + Intronic
1142496615 17:309584-309606 GGCTCCTGCCAGCCTCCTGCTGG + Intronic
1142496655 17:309697-309719 GGCTCCTGCCAGCCTCCTGCTGG + Intronic
1142694597 17:1626887-1626909 GGCTGCTGTGGCCCTCCTGTGGG + Intronic
1143112158 17:4558851-4558873 GGCTCAGGAGGGCTTCCTGGTGG - Exonic
1145062966 17:19743926-19743948 GGGCGCTCAGGGCCTCCTGTGGG + Intronic
1145261245 17:21355967-21355989 AGCTCCAGAGGGCTTCCTGGGGG + Intergenic
1147677864 17:42219886-42219908 GGCTTCTCTGGGCCTCCTGTTGG - Intronic
1147688177 17:42299685-42299707 GGCTTCTCTAGGCCTCCTGTTGG + Intronic
1148238143 17:45983066-45983088 GGCTCCTGAGGGCCTCCTGTTGG - Intronic
1150295611 17:64005750-64005772 GGCTACAGAGGGCCCTCTGTGGG - Intronic
1151188132 17:72378873-72378895 GGCTCCTGGAGGACTCCTGCTGG + Intergenic
1152155442 17:78629730-78629752 GCCCACTGAGGGCCTCCAGTTGG - Intergenic
1152423426 17:80206026-80206048 GGCATCTGCGTGCCTCCTGTAGG + Intronic
1152524295 17:80878907-80878929 GGGTCCTGTGGGCGTCCTGGAGG - Intronic
1152581617 17:81167854-81167876 GGCCTCTGAGTGCCTCCTGCGGG - Intergenic
1157584104 18:48790475-48790497 GGCTCCATGGGGCGTCCTGTTGG - Intronic
1158188476 18:54798269-54798291 GATTCCTCAGGGTCTCCTGTTGG - Intronic
1158396322 18:57080986-57081008 GGCTCCAGAGGGCAGCCTCTCGG + Intergenic
1160717437 19:582682-582704 GGCTCCTGGGTCCCGCCTGTGGG + Intronic
1160754575 19:750893-750915 GGCTCCTCGGGGCCACCTGGAGG + Intergenic
1161356664 19:3822976-3822998 GGCTCCGCAGGGTCCCCTGTTGG + Intronic
1161820682 19:6529137-6529159 GGGTCCCGAGGGGCTCCTGCCGG + Intergenic
1163294321 19:16402431-16402453 GGCTCCTGTGGGCCTCCTGGCGG + Exonic
1163722115 19:18903282-18903304 GGCCGCTGAGGGCCTGCTGCAGG - Exonic
1163818274 19:19481222-19481244 GGCTCCTGAGGGCCTGGTGTGGG - Intronic
1165263404 19:34639927-34639949 GGTTCCTGAGGGCTTGCTCTTGG + Intronic
1167948717 19:53009825-53009847 GGGGCCTGAGGGCCTAGTGTAGG - Intergenic
925018689 2:551887-551909 GCCTCCCGCGGGCCTCCTGCCGG + Intergenic
925763528 2:7209298-7209320 AGCTTCAGAGGGCTTCCTGTGGG + Intergenic
928082851 2:28325954-28325976 TGTTCCTGAGGCCCTCCTTTGGG + Intronic
928168058 2:28985000-28985022 GGCTCCTGATGGCCTTATGTAGG + Intronic
929841256 2:45466281-45466303 AGCTCCAGAGAGACTCCTGTGGG - Intronic
931077842 2:58736161-58736183 GGCTCCTGAGGGACTCCAGTGGG + Intergenic
932604528 2:73156379-73156401 AGGTCCTGAGGACATCCTGTAGG - Intronic
932667328 2:73708169-73708191 GCCTCCAGTGGGCCTCCAGTGGG - Intergenic
932917555 2:75874676-75874698 GACTCTTGAGGGCTTCCTGTAGG - Intergenic
932976896 2:76613530-76613552 AGCTGCTGAGGGCTTCCTGCTGG + Intergenic
933758900 2:85661290-85661312 GGCTCCTGAGGGCTTCTGGCTGG - Intronic
934098123 2:88626753-88626775 GGCTCCCGAGGGCCTGGTGCTGG - Intronic
934729848 2:96649634-96649656 TGCTCATGTGGGCCACCTGTAGG - Intergenic
935105809 2:100042252-100042274 GGCTGCGGAGGGCCCTCTGTGGG - Intronic
935365949 2:102291336-102291358 AGCTCCTGAGGGCCTGTTGAGGG + Intergenic
935379251 2:102433900-102433922 GGCACCTGTTGGCATCCTGTGGG + Intronic
935686361 2:105687532-105687554 GGCTCCTGTGGGCCTCGTTGAGG - Intergenic
938455976 2:131464606-131464628 GCCTCCTGAGGGGCTTCTGAGGG + Intergenic
946000781 2:216480519-216480541 GGCTGATGAGGGCATCCTGGAGG + Intronic
946278536 2:218649085-218649107 GGCTCTTGAGGTGCTCCTTTAGG + Exonic
947184335 2:227441685-227441707 GAATCCTCAGGGCCTGCTGTGGG - Intergenic
948381280 2:237551457-237551479 GGCTCCTGAGAGCTGACTGTGGG - Intronic
948733044 2:239979423-239979445 GGCTGCTGAGGGCCTGGTGGTGG - Intronic
948873395 2:240815187-240815209 GGCTCCTGAGGAGCTGCTGTGGG - Intronic
1170640734 20:18150424-18150446 GGCACCTGGAGGCCTCCTGCTGG + Intronic
1171002185 20:21425895-21425917 GGCCCCTGAGGGGCACATGTGGG + Intergenic
1171199498 20:23230027-23230049 GGCTCCTCAGGGCCACCAGTCGG - Intergenic
1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG + Intronic
1172189243 20:33051984-33052006 GGCTCATGAAGGCTTCCTGGAGG + Intergenic
1172284578 20:33731917-33731939 GGCTCCTGGGCGCCCCCTGGCGG + Exonic
1174114261 20:48215930-48215952 TCCTCCCCAGGGCCTCCTGTGGG + Intergenic
1174167541 20:48595940-48595962 TCCTCCCCAGGGCCTCCTGTGGG - Intergenic
1174570215 20:51496064-51496086 GGCTCCTCTGGGCATCTTGTTGG - Intronic
1175764272 20:61582016-61582038 GCCTCCTCAGGGCAGCCTGTGGG + Intronic
1175943689 20:62549254-62549276 GGCTCCTCAGGGGCTCCCCTGGG + Intergenic
1176033365 20:63024494-63024516 GGAGCCTCTGGGCCTCCTGTGGG + Intergenic
1176219643 20:63963898-63963920 TGCTCTTCAGGGCCACCTGTGGG + Exonic
1177791624 21:25728572-25728594 GTCTACTGAAGGCCTCCTGTGGG + Intronic
1178855341 21:36245832-36245854 GGCCAATGAGGGCCTCCTGGTGG - Exonic
1179101248 21:38357172-38357194 GGCTTCTGAGGCCTTCCTGGTGG + Intergenic
1179259243 21:39743655-39743677 AGATTCTGAGGGCTTCCTGTAGG + Intergenic
1179451904 21:41473632-41473654 GGCTCCTGGGGGTCTCCTCTTGG + Intronic
1179495095 21:41766593-41766615 GGCTCCTCTGGGGCTCCTCTGGG - Intronic
1179551609 21:42147056-42147078 GGGTGCTGAGTGCCTCTTGTGGG + Intergenic
1180001928 21:44998995-44999017 GGCTCCTGACAGATTCCTGTGGG - Intergenic
1180198420 21:46210820-46210842 GGCGCCTGAGGGCCAGGTGTGGG + Intronic
1181022898 22:20112833-20112855 GGCTAATCAGGGGCTCCTGTGGG + Intronic
1181030402 22:20146737-20146759 GGTTCCTGAGAGTCCCCTGTGGG - Intronic
1181055866 22:20260273-20260295 GTCTCCTCAGGGCCTCCCGAGGG - Intronic
1181130130 22:20726379-20726401 GGCTCCTCAGAGCCTCCTCAGGG - Intronic
1182014374 22:27026663-27026685 GTTTCCTGAGGGCCTCCCCTGGG - Intergenic
1182046923 22:27282409-27282431 GACTCCTGAGCCCCTCCTGTAGG - Intergenic
1183674664 22:39292585-39292607 GCCTCCTGAGCACCTGCTGTGGG + Intergenic
1184090289 22:42289758-42289780 GGCTCCTGGTGGCCTCAGGTGGG - Intronic
1184280836 22:43436570-43436592 GGCTCCTGAAGTCCTTCTCTGGG + Intronic
1184533838 22:45073043-45073065 GGCCCCTGAGGTCCTACTGTGGG + Intergenic
1184806626 22:46798805-46798827 GGCTCCTGCGTGGCTCCTGGCGG - Intronic
1184822222 22:46917914-46917936 TGCTGCTGAGGGCCGCCTTTGGG + Intronic
1185343419 22:50301359-50301381 GCTTCCTGAGGACCTCCTGTGGG + Intronic
950442997 3:13020568-13020590 GGGTCCTGAGGTTCTTCTGTTGG - Intronic
953419029 3:42740400-42740422 GTTTCCTGAGGGCCTACTATGGG + Intronic
953419039 3:42740445-42740467 GTTTCCTGAGGGCCTACTATGGG + Intronic
954096549 3:48333072-48333094 AGATTCTGAGGGCTTCCTGTAGG + Intergenic
954454233 3:50588441-50588463 GGCTCCTGAGGCCCCTCTGGGGG - Intergenic
956177174 3:66483892-66483914 GGCGCCCGAGGACCTCATGTGGG + Intronic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
961119049 3:124357640-124357662 GGCTACTGAGGGCTTCCTAGAGG - Intronic
961946312 3:130692705-130692727 GGCCCCTGTGGGGCCCCTGTGGG - Intronic
966353383 3:179055435-179055457 GGACTCTGAGGGCTTCCTGTAGG - Intronic
969608227 4:8212756-8212778 GGCCCCGGAGGGTCTGCTGTAGG - Exonic
969631709 4:8342890-8342912 GGCTCAGGAGGGCCCCCTGGAGG + Intergenic
969637090 4:8375499-8375521 GGCCCTTGGGGGCCTCCTGGTGG - Intronic
970407234 4:15775431-15775453 GGCTCCTTGATGCCTCCTGTTGG + Intergenic
970569463 4:17365612-17365634 GGCTCCTGAGAGCTGACTGTGGG - Intergenic
976296566 4:83478532-83478554 GTCTCCTAAGGGCCTCCTGATGG + Intronic
985683829 5:1271410-1271432 GTCTCCTCTGGGCCACCTGTGGG + Intronic
985726224 5:1517185-1517207 AAGTCCTGTGGGCCTCCTGTGGG - Intronic
985758637 5:1733559-1733581 GGCTGCTGAGGGGCCCCTGAGGG - Intergenic
985956426 5:3269224-3269246 TGAGCATGAGGGCCTCCTGTGGG - Intergenic
986346896 5:6844125-6844147 GGCTTCTCAGGGCATTCTGTAGG - Intergenic
988577470 5:32441437-32441459 GGTTCCACAGGGCCTACTGTGGG - Intronic
989506840 5:42236136-42236158 GGTTGCTTAGGGGCTCCTGTGGG - Intergenic
989567166 5:42912377-42912399 GGCATCTGAGTGCCCCCTGTGGG - Intergenic
992805376 5:80332131-80332153 AGCTCCAGAAGGGCTCCTGTGGG - Intergenic
993047186 5:82880990-82881012 GGCTGCTGAGTGGCTCATGTGGG + Intergenic
994588886 5:101748610-101748632 AGCTTCTGAGGGCCTATTGTGGG + Intergenic
997235699 5:132270931-132270953 GGTGCCTGAGGGCCGCCTGCTGG - Exonic
997358460 5:133279490-133279512 GGCTCCTGGGCCCCACCTGTTGG - Intronic
998750278 5:145313567-145313589 GGCTACTGTGGGACCCCTGTAGG + Intergenic
999304550 5:150511273-150511295 GGCTCTTGAGTACCTGCTGTGGG + Intronic
1002741533 5:181438234-181438256 GGGTCCTGAGGGCCACCCTTCGG - Intergenic
1003370433 6:5520236-5520258 GGTTCCTGAGGCCCCCATGTGGG + Intronic
1006047070 6:31307593-31307615 GGCTCCTGAGGCTCTCCCATGGG - Intronic
1010051118 6:71505359-71505381 AGCTCCTGAGGTCCTTGTGTGGG - Intergenic
1010969818 6:82251427-82251449 GGCACCTGACGGACTCATGTCGG + Intergenic
1015263607 6:131266069-131266091 GGCTGCTGAGGGTCTCCTCCCGG - Intronic
1015985080 6:138876382-138876404 GGCTTCTGAGGGCCTCCTGCGGG + Intronic
1016908666 6:149176065-149176087 GCCTGCAGAGGGCCTACTGTGGG - Intergenic
1018696611 6:166396237-166396259 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696621 6:166396279-166396301 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696632 6:166396321-166396343 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696642 6:166396363-166396385 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696652 6:166396405-166396427 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696663 6:166396447-166396469 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696674 6:166396489-166396511 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696683 6:166396531-166396553 GCCTCCTGAGGGACACCTGCTGG - Intergenic
1018997231 6:168719206-168719228 GGCCCCTGGGGGACTCATGTGGG - Intergenic
1019014766 6:168871858-168871880 TTCTCCTGGGGGCCTCCGGTCGG - Intergenic
1019198552 6:170296317-170296339 CGCACCTGAGGGCTTCCTGGAGG + Intronic
1019246669 6:170713999-170714021 GGGTCCTGAGGGCCACCCTTCGG - Intergenic
1019684331 7:2372410-2372432 GGCTCCTGCGGTCCTGCTGTGGG + Intronic
1021100816 7:16584958-16584980 GGCCCCTCAGTGCCTCCTGCTGG + Intergenic
1021141631 7:17033208-17033230 GGCTCCTGATCACCTGCTGTGGG - Intergenic
1021801997 7:24316565-24316587 GTCTCATGAGGCCCTCCCGTTGG - Intergenic
1023271260 7:38465357-38465379 GGCTCCTGTGGGACTTTTGTAGG + Intronic
1023869818 7:44257182-44257204 GGGGCCTCAGGGCCTCCTGAGGG + Intronic
1024961382 7:54980688-54980710 GGCGCCCGAGGGCGTCCTGGGGG - Intergenic
1026312540 7:69199631-69199653 GCCTCCTGTGGACCTCCTGTTGG - Intergenic
1029494159 7:100888280-100888302 GGGTATGGAGGGCCTCCTGTGGG - Exonic
1031280995 7:119798845-119798867 GGCTCCATAGGGTCACCTGTGGG + Intergenic
1031459320 7:122026523-122026545 TGCTCATGTGGGCCTTCTGTAGG + Intronic
1031971374 7:128067439-128067461 GGCTGCTCAGGGCTACCTGTGGG - Intronic
1032192996 7:129775091-129775113 CGCTGCTGAGGGCCTGCTGGGGG - Intergenic
1033145592 7:138868002-138868024 GACGCCGGGGGGCCTCCTGTAGG + Exonic
1034914273 7:155023936-155023958 GGCTGCTGAGGGACACCAGTAGG - Intergenic
1035231518 7:157468706-157468728 GTCTCCTGAGGGCCACCAGCAGG - Intergenic
1035315725 7:157996867-157996889 GTCTCCTGAGGGCCTGGCGTGGG - Intronic
1035501471 8:93962-93984 GGGTCCTGAGGGCCACCCTTCGG + Intergenic
1035700043 8:1631522-1631544 GGTTCCTGAGGCCATCCTGCCGG + Intronic
1036661763 8:10713871-10713893 GGCTGCTGCTGGTCTCCTGTGGG - Intergenic
1037523664 8:19703890-19703912 GGCTCCTGAGAGCTGCGTGTAGG - Intronic
1037951869 8:23023891-23023913 TGCCCCTGAGGACCTCCTGAGGG - Intronic
1045317752 8:101058041-101058063 GGCTCCTGTGGACCCCCTGGGGG + Intergenic
1049415483 8:142492980-142493002 GGCTCCTGAAGGCCACCAGCAGG - Intronic
1049588940 8:143446811-143446833 GGCCCCAGAGGGCCCCCTGTGGG - Intronic
1049660828 8:143819019-143819041 GGCTCCTGAGCTCCTCCCCTGGG - Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1055185488 9:73447618-73447640 GGTTCCACAGGGCCTACTGTAGG + Intergenic
1056772849 9:89492276-89492298 GGGTTCTGAGGGCATCCTGGAGG - Intronic
1056954928 9:91074151-91074173 GGCTCCGGAAGGCCACCTCTGGG - Intergenic
1057040495 9:91844303-91844325 GGTTCCTGGGGGCCTCCTCTGGG + Intronic
1057305358 9:93909161-93909183 GGCTGCCGAGGGCCTCCGGCAGG - Intergenic
1060596686 9:124852992-124853014 GGCTCCTGAGGGGGCCCTCTTGG + Intergenic
1062014008 9:134282289-134282311 TGCTCCTGAGTGCCTCCCGATGG + Intergenic
1062287501 9:135779569-135779591 GGCTCCTGCCGCCCTCCTGCTGG + Intronic
1062651718 9:137581170-137581192 GGCTTCTCAGGGCCTGATGTGGG + Intergenic
1203607445 Un_KI270748v1:69450-69472 GGGTCCTGAGGGCCACCCTTCGG - Intergenic
1186515164 X:10161359-10161381 CGCTCCTGTGTGCCTCCAGTGGG + Intronic
1186600353 X:11030187-11030209 GGCTCTTGTGGTCCTCCTGAAGG + Intergenic
1196157736 X:112449397-112449419 TGCACCTTAGGGGCTCCTGTTGG + Intergenic
1196793317 X:119483215-119483237 GGATCCTGAGAGTCTCCTTTGGG - Intergenic
1197803140 X:130373058-130373080 GTCTCCTAAGGGCCTCCTGATGG + Exonic
1198414045 X:136401861-136401883 GTCTCCTGACAGCCTCCTGGAGG + Intronic
1199728011 X:150604071-150604093 GGCTCCTGTGAGCCTCCTCCTGG - Intronic
1199875087 X:151922421-151922443 GGGTTCTGATGGCCTCCTGTGGG - Intronic
1199954927 X:152735043-152735065 GGCTTCTGATGGCCTCCTGTGGG - Intronic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201371526 Y:13269689-13269711 GGCACCTGAGGGAATCCTCTGGG + Intronic