ID: 1148239366

View in Genome Browser
Species Human (GRCh38)
Location 17:45989971-45989993
Sequence GGGCACACAGCAGGGCTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 709
Summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 630}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148239366_1148239377 28 Left 1148239366 17:45989971-45989993 CCCTCCAGCCCTGCTGTGTGCCC 0: 1
1: 0
2: 4
3: 74
4: 630
Right 1148239377 17:45990022-45990044 TCTTCTGTCACTTCCCGAACTGG 0: 1
1: 0
2: 0
3: 9
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148239366 Original CRISPR GGGCACACAGCAGGGCTGGA GGG (reversed) Exonic
900250286 1:1665309-1665331 GGCCACAGAGCAGGGCCGAAGGG - Exonic
900360022 1:2283959-2283981 GGGCAGACAGCAGCTCTGGAGGG - Intronic
900472210 1:2860553-2860575 GGGGACCCCGCAGGGCTGGCAGG + Intergenic
900482944 1:2908155-2908177 TGGGACACAGCAGGGCGGGGAGG - Intergenic
900532743 1:3162730-3162752 TGCCACACAGGAGGACTGGAGGG - Intronic
900621293 1:3588668-3588690 GGGCACAGAGAAGGGCTCCAAGG + Intronic
900637672 1:3673977-3673999 GGGCACACAGCTGGTCAGGGTGG - Intronic
900704834 1:4073949-4073971 GGGCTCACAGGAGGACTGGCAGG - Intergenic
900728050 1:4231325-4231347 GGGAACACTGTAGGGCTGGATGG + Intergenic
900745902 1:4360624-4360646 TCTCACTCAGCAGGGCTGGATGG - Intergenic
901148651 1:7085753-7085775 TGGGAGCCAGCAGGGCTGGAGGG - Intronic
901181650 1:7346238-7346260 GGTCACACAGCAAGGCAGCATGG - Intronic
901188378 1:7389306-7389328 GGAGACCCAGCAGGGCTGCAGGG - Intronic
901643685 1:10705606-10705628 GGGTACTCAGGAGGGATGGAGGG - Intronic
901686315 1:10945554-10945576 GGGCCCTGAGGAGGGCTGGAAGG - Intergenic
901740830 1:11340589-11340611 GATCACACAGCAGGTCAGGAGGG - Intergenic
901881954 1:12199261-12199283 AGGCTCAGAGCAGGGCTGGGGGG + Intronic
901884808 1:12215362-12215384 GGGCACAAAGCAGGGCAGAGAGG - Intergenic
902597570 1:17520000-17520022 GGGTACAGGGCAGGGTTGGAGGG - Intergenic
903365961 1:22805565-22805587 GTCCAGACAGCTGGGCTGGAGGG + Intronic
903620419 1:24694075-24694097 GGTCACACAGCAAGGCTGAGTGG - Intergenic
903847906 1:26289467-26289489 GGGTGCCCAGCATGGCTGGAAGG - Intronic
904461737 1:30684778-30684800 TGGCACACAGCAGGGCAGCATGG + Intergenic
904748282 1:32724843-32724865 GGGCACAGAGTGGGGCAGGAAGG + Intergenic
904834211 1:33324484-33324506 GGGCAGCCAGCAGGCCTGGATGG - Exonic
904949649 1:34226196-34226218 GGGCACACAGGAGGGCTTTATGG + Intergenic
905233245 1:36528800-36528822 GGACACACAGCAGGAAGGGATGG - Intergenic
905254588 1:36672010-36672032 GGGCACTCTGGAGGGGTGGAAGG - Intergenic
905372369 1:37490159-37490181 GGGCACACAGGATGGCTGGGTGG - Intergenic
905461691 1:38126527-38126549 GGGGACCCAGCAGGGGTGGGCGG - Intergenic
905611229 1:39353592-39353614 GGACAGAAATCAGGGCTGGAAGG - Intronic
905674563 1:39816567-39816589 GGGGGCACAGGATGGCTGGAGGG + Intergenic
906460501 1:46032415-46032437 AGGGAGACAGCAGGTCTGGATGG - Intronic
906636673 1:47415132-47415154 GGACATGGAGCAGGGCTGGAAGG - Intergenic
906675729 1:47692428-47692450 AGGCACACAGCATGGCAGGCGGG - Intergenic
907280525 1:53344205-53344227 GTTCAGACTGCAGGGCTGGAAGG + Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908326492 1:63028717-63028739 AGGCACAGAGGAGGGCTAGAGGG - Intergenic
908898797 1:68931794-68931816 GTGCAGACAGCAGGGCTTTAGGG + Intergenic
912706550 1:111919323-111919345 GGGCACACAGCTGAGGTGGGTGG + Intronic
912731903 1:112114643-112114665 GGAAGCAAAGCAGGGCTGGAGGG + Intergenic
912777229 1:112513429-112513451 GGGAACTCAGCAGGGCTGATGGG - Intronic
914196166 1:145449099-145449121 GGGGACAAAGAAGGGGTGGATGG + Intergenic
915493098 1:156262598-156262620 GGGCACATGGGAGGGCTGGAAGG - Intronic
915555504 1:156658702-156658724 GGGCACACAGGAGATCTGGGGGG - Exonic
916206348 1:162319499-162319521 GGGCATACAGAAGGACTGGTGGG - Intronic
917196090 1:172467210-172467232 GGGAACACAGCACAGGTGGAAGG - Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917724782 1:177818049-177818071 GGGCATACAGCATGTTTGGATGG - Intergenic
917788800 1:178486748-178486770 GAGGCCGCAGCAGGGCTGGAGGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919760327 1:201094084-201094106 GGGAACCCAGCACGGCTGCAGGG - Intronic
919766023 1:201127771-201127793 GGACACAGTGCAGGGCTGGGGGG + Intergenic
919962386 1:202484981-202485003 GTGGCCACAGCAGGGCTGGGTGG + Intronic
920034898 1:203059410-203059432 GTGGGCACAGCAGGGCTGGGAGG + Intronic
920440697 1:205978745-205978767 GGGCAGGCAGTGGGGCTGGAGGG + Exonic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921245267 1:213232163-213232185 GGGCACACAGCGGGGGATGATGG - Exonic
922176787 1:223203248-223203270 GAGCACACAGCAGGCCTGGCAGG + Intergenic
922470531 1:225874455-225874477 CCGCACTCAGCAGGGCTAGAAGG + Intronic
922822682 1:228494867-228494889 GGGGACTCAGAAGGGCTGAAAGG - Exonic
922850765 1:228731799-228731821 ATGCTCACAGCTGGGCTGGAGGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924332426 1:242953438-242953460 GGGCCTACTGCAGGGATGGAAGG + Intergenic
924834548 1:247635674-247635696 GGGCCCACTGCAGGGCTGTGAGG + Intergenic
924941296 1:248813835-248813857 GAGCACACAGCACGGGGGGAGGG - Intronic
1062963550 10:1591269-1591291 GGCCACACTGCAGGGCTGCTCGG + Intronic
1063123839 10:3123524-3123546 AGGCACACAGGAGGGCAGGTGGG - Intronic
1063385084 10:5611327-5611349 TGGCACACAGCAGGGAGGGCTGG + Intergenic
1063631915 10:7741969-7741991 AGGCAAACAGCAAGGCTGAATGG - Intronic
1063739172 10:8797926-8797948 GGGCACACAGTAGGGCTGAAAGG + Intergenic
1064981693 10:21173139-21173161 GGGCAGGGGGCAGGGCTGGAGGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065981503 10:30902785-30902807 GGGCACACTGCGGGACTGGCAGG - Intronic
1066209638 10:33224234-33224256 TGGCACACAGAAGGGCTTCAAGG - Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067152478 10:43748245-43748267 GGAGGCACAGGAGGGCTGGAGGG + Intergenic
1067413373 10:46084579-46084601 GGGCACAGAGCAGGGTGGGGAGG + Intergenic
1068787224 10:60989778-60989800 GGGGAGAGAGCAGGGGTGGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069069672 10:63980356-63980378 GGAGACACAGCAGGTCTGTAAGG - Intergenic
1069543872 10:69315654-69315676 GGGGACACAGCAGTGCAGCATGG + Intronic
1069717832 10:70532296-70532318 GAGCACACAGGAGGCCTGGAGGG - Intronic
1069823123 10:71239700-71239722 GGGCACACACCCCTGCTGGATGG + Intronic
1069867904 10:71515033-71515055 GGGCACACTGGAGGGCTGAGGGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071513697 10:86283118-86283140 AGGCACACAGCAGGGCAGGGAGG - Intronic
1072049596 10:91690106-91690128 GGCCACACAGCATGCCTGGAGGG - Intergenic
1072174456 10:92903956-92903978 GGGTTCACAGCAGGGAAGGATGG - Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072637905 10:97189069-97189091 GGGCACAGAGTGGGGCTGGAAGG + Intronic
1073035245 10:100560301-100560323 GGGAAGACAGCCTGGCTGGAGGG - Intergenic
1073468713 10:103709449-103709471 TGGGACACAGCAAGGATGGAAGG + Intronic
1075322184 10:121500189-121500211 GGGCATGAAGCAGGGTTGGAAGG + Intronic
1075683777 10:124350072-124350094 CGGGACAGTGCAGGGCTGGAGGG + Intergenic
1076014830 10:127019172-127019194 GGGCAAATGGCAGGGTTGGATGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076511845 10:131019814-131019836 GGGCACAGGGCATGGCTGGGGGG - Intergenic
1076887870 10:133270851-133270873 GGGCACAGAGCTGGCCTGGCAGG - Intronic
1076939215 10:133590549-133590571 TGTCACACAGCAGGGCTGGGTGG - Intergenic
1077186401 11:1237241-1237263 GGGCAGACAGCAGCGCTCCAAGG + Intronic
1077242577 11:1518326-1518348 GGACACACAGTAGGACGGGAGGG - Intergenic
1077359182 11:2133121-2133143 GGGCACGCAGGAGGGCAGGCAGG + Exonic
1077361602 11:2143217-2143239 TGACACTCAGCAGGGCTGGAAGG - Intronic
1077516858 11:3007288-3007310 GGGCCGACAGCAGGGGTGGGAGG + Intronic
1078153569 11:8779163-8779185 GGGGACAGAGCAGCTCTGGACGG + Intronic
1078267596 11:9766548-9766570 GGCCACACAGCAGTGCCTGATGG - Intergenic
1078609044 11:12803549-12803571 GGCCACACAGCTGGCATGGAGGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081745055 11:45467264-45467286 GGGCAGAAAGCAGAGCTGCAGGG + Intergenic
1081853594 11:46290451-46290473 CGGCAGAGGGCAGGGCTGGAAGG - Intronic
1083173515 11:60936164-60936186 GGGCTCCAAGCAGGGCTGGATGG - Exonic
1083843567 11:65317999-65318021 GGGTACACAGCAGGGATGGGGGG - Intronic
1083897834 11:65629032-65629054 GGGCCCACAGCAGGTATGGGAGG + Intronic
1084148491 11:67277402-67277424 GGGAGCACAGCTGGGCTGGCTGG - Intronic
1084356945 11:68645356-68645378 GGGAGGACGGCAGGGCTGGAGGG + Intergenic
1084433197 11:69122863-69122885 GGCCGCACAGCAGGGCGGGCAGG - Intergenic
1084442652 11:69183798-69183820 GGCCACAGAGCAGTGCTGGAGGG + Intergenic
1084569276 11:69949736-69949758 TGGCCCCCAGAAGGGCTGGAAGG + Intergenic
1084809506 11:71603688-71603710 GTGGACACTGCAGGGGTGGAAGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084954897 11:72685903-72685925 GGGCCCCCACCAAGGCTGGAGGG + Intronic
1085333083 11:75668837-75668859 GGCCACCTAGCAGGGCTGGGAGG + Exonic
1085343077 11:75746211-75746233 GGGCACACAGCTGGGCTCCCAGG + Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085777952 11:79383071-79383093 GGGCACAGAGCAGGGCAGAAAGG - Intronic
1086777263 11:90853979-90854001 GAGCAAACAGAAGGGCTGGATGG - Intergenic
1089155771 11:116401271-116401293 GGGAACACAAGAGGGTTGGAGGG - Intergenic
1089324004 11:117644831-117644853 GGGATCTCAGCAGGGCTGGCTGG + Intronic
1090404387 11:126468182-126468204 GTCCACACAGCAGGGGAGGAAGG - Intronic
1090780205 11:130001492-130001514 GGGCACAGGGCAGAGCTGGGTGG + Intronic
1091120988 11:133057423-133057445 AGGCACAGAGCAGGACAGGAAGG - Intronic
1091188581 11:133669857-133669879 GGGCAGACAGCAGGGCGGGGCGG - Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095085054 12:38051432-38051454 GGGCAGACAGAAGAGCAGGAGGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096382690 12:51172562-51172584 GTGCACAGAGCAGTGCTGGTCGG - Exonic
1096496784 12:52043354-52043376 GGGTACACAGCAGCCCTGGTGGG + Intronic
1096520797 12:52183520-52183542 GGGCAAACAGCCTGGCTGGAGGG - Intronic
1096786803 12:54021541-54021563 GGGACCAGAGCGGGGCTGGAGGG + Intronic
1097261573 12:57723486-57723508 TGGCAGCCAGCAGGGCTGCAGGG + Intergenic
1099286301 12:80717184-80717206 GCGCACAAAGCAGAGCTGCAGGG + Exonic
1102112079 12:110372183-110372205 GGGCTCTCAGCAGGGCTGAGGGG + Intergenic
1103516496 12:121511843-121511865 TGGCACACAGCAGCTCTGGATGG + Intronic
1103576478 12:121881323-121881345 GGGCACAGAGAAGGGCAGGGAGG - Intergenic
1103931641 12:124453802-124453824 GTCCCCACAGCTGGGCTGGAGGG + Intronic
1104270864 12:127281005-127281027 GGGCACTGGGCAGGGCTGGAGGG + Intergenic
1104502785 12:129302503-129302525 GCCCACAGATCAGGGCTGGAAGG - Intronic
1104558342 12:129822196-129822218 GGGCACTGAGCAGGGCTGGAGGG + Intronic
1104702883 12:130920564-130920586 GAGACCACAGCAGGGCTGAATGG + Intergenic
1104771923 12:131369055-131369077 GGTCCCACGGCAGGGCAGGAAGG + Intergenic
1104930561 12:132337268-132337290 GTGCCCACATCAGGGCTGGCGGG - Intergenic
1104963870 12:132500501-132500523 GGACACACAGCAGGACCGGCTGG - Intronic
1106235635 13:27858091-27858113 GTACACACAGCCGGGGTGGATGG - Intergenic
1106904003 13:34386040-34386062 GGGCAGAGAGTAGGTCTGGAAGG - Intergenic
1107732875 13:43365901-43365923 GGGCACAGAGACAGGCTGGAAGG + Intronic
1108597952 13:51965733-51965755 GGGAAGGCTGCAGGGCTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112578255 13:100656429-100656451 GGGCACACAGGAGGTCTGCACGG + Exonic
1113418795 13:110153887-110153909 TCGCACACAGCACGTCTGGAAGG + Intronic
1113812829 13:113152965-113152987 AGGGAGACAGCGGGGCTGGATGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114398755 14:22390081-22390103 GGGCACACAGCAGAAGGGGAGGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117318394 14:54596809-54596831 GGGCACACATCAGGGTGAGAAGG + Intronic
1117800863 14:59443316-59443338 GAACCCACAGCAGGGATGGATGG - Intronic
1118784860 14:69037632-69037654 GGGCATGCACCAGGGCAGGAAGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119162600 14:72465518-72465540 GGGCACATAGCAAGGGTGGGTGG + Intronic
1119639263 14:76302489-76302511 GGGCTAGCTGCAGGGCTGGATGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121194609 14:92058728-92058750 GCACACACAGAAGGGCTGCAGGG + Exonic
1121235533 14:92389058-92389080 GGGGAGGCAGCAGGGCTGGCAGG + Intronic
1121310530 14:92933028-92933050 GGGCACCCAGCAAAGCTGGCTGG + Intronic
1121332848 14:93059348-93059370 GGTCACAAGGCAGGGGTGGAGGG + Intronic
1121332920 14:93059571-93059593 GGTCACAAGGCAGGGGTGGAGGG + Intronic
1121404669 14:93712524-93712546 GGGCAGACAGCATGGCTGAGTGG - Intergenic
1121413498 14:93763431-93763453 GAGCTCACTGCAGGCCTGGAAGG - Intronic
1121813336 14:96910761-96910783 AGGCACAGAGCAGGTATGGAGGG + Intronic
1121813350 14:96910832-96910854 GGGCACAGAGCAGGTATGGAGGG + Intronic
1122097331 14:99381430-99381452 GTGCACGCAGCAGCACTGGAAGG - Intergenic
1122275305 14:100587836-100587858 GGGCCTACAGCAGGGCTGGTTGG - Intergenic
1122293814 14:100693921-100693943 GGGTACGCAGAAGGGGTGGACGG - Intergenic
1122505341 14:102228285-102228307 GGGCACAGGGCAGGCCTGAAGGG - Intronic
1122557567 14:102589995-102590017 GGGGACACAGCCCTGCTGGATGG + Intergenic
1122707168 14:103628841-103628863 GGGCCCACAGTCCGGCTGGAAGG + Intronic
1122740050 14:103867075-103867097 GGACACACTGCAGGGCTGGGGGG + Intergenic
1122969666 14:105147462-105147484 GGGGCCACAGCAGGGGTGGGTGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123783298 15:23646593-23646615 GGCCACGCAGCAAGGCTGGCAGG - Exonic
1123867482 15:24535435-24535457 GGTCACACAGGATGGCTGAAAGG - Intergenic
1124862139 15:33452172-33452194 GGGTACAAATCAGGGCTGAAAGG + Intronic
1124898667 15:33801539-33801561 TGACAGACAGCAGGCCTGGAAGG - Intronic
1125800195 15:42439284-42439306 GGGAAGACAGCAGGACTGGTCGG - Exonic
1126104537 15:45138947-45138969 GAGCAAACAGCAGGACTGGGTGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127882419 15:63170031-63170053 GGGCACCCGCCAGGGCAGGAAGG + Intergenic
1127930889 15:63596781-63596803 TGGCAGGCAGCAGGGCTTGAAGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128707603 15:69848913-69848935 AGGCACACAACAGTGCTGCATGG + Intergenic
1129060011 15:72853236-72853258 GGGCTCACAGCAGTGGAGGAGGG + Intergenic
1129193408 15:73950928-73950950 GGGCACACAGCATGTTTGAAAGG + Intronic
1129328110 15:74812674-74812696 GGCCTGACAGCAGGCCTGGAAGG + Intergenic
1129605572 15:77023398-77023420 GGGCAGAGAGCAGGGCTGACAGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130903693 15:88225562-88225584 GGGGACAGGGCAGGGCTGCAGGG + Intronic
1131013914 15:89041916-89041938 GGTCAAACATCAGGGCAGGAGGG + Intergenic
1131157823 15:90085571-90085593 GGGCCCAGCACAGGGCTGGAGGG + Intronic
1131434644 15:92413141-92413163 GGGCACTGAGCAGGGCTCTAGGG - Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131986847 15:98051275-98051297 GGCCACACAGCAAGGCAGCAGGG - Intergenic
1132667575 16:1089222-1089244 GGTGAGAGAGCAGGGCTGGATGG - Intergenic
1132764525 16:1527444-1527466 GGGCACAGGGCTGGGGTGGAAGG - Intronic
1132805930 16:1775148-1775170 ATGCCCACAGCAGGGCTGGCTGG + Intronic
1132938155 16:2492557-2492579 GGGCCCATAGCAGGGAAGGAGGG + Intronic
1133245382 16:4445335-4445357 GTACAGACAGCAGGGATGGAAGG + Intronic
1133409846 16:5559041-5559063 GGGTACAGAGCTGGGCTGGGGGG + Intergenic
1134014536 16:10879123-10879145 GGTCACACAGCAAGTCTGGGAGG + Intronic
1134556073 16:15166360-15166382 GTGCTCCCTGCAGGGCTGGAGGG + Intergenic
1134636356 16:15794832-15794854 TGGCTCCCAGCATGGCTGGAGGG + Intronic
1134916657 16:18078095-18078117 GTGCTCCCTGCAGGGCTGGAGGG + Intergenic
1136072596 16:27796983-27797005 TGGCACACAGCAGGAGTGGGAGG - Intronic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1137409565 16:48216329-48216351 GGGTACACAGAAGGGGTGGCAGG + Intronic
1137469437 16:48741365-48741387 GGCCACAAAACAGGGCTTGAAGG - Intergenic
1137505512 16:49050873-49050895 AGGCACTCAGTAGGTCTGGAGGG - Intergenic
1137566723 16:49537978-49538000 GGGCAGACAGGAGGGCTGGCTGG - Intronic
1137722119 16:50633485-50633507 GGGGACACCGCAGGGATGGCGGG - Exonic
1138156567 16:54710657-54710679 AGACACACAGCAAGGCTAGAAGG + Intergenic
1138293690 16:55869118-55869140 GGGCACACAGTGGGGCTACATGG + Intronic
1138461355 16:57149750-57149772 GGGCAGACAGCAGAGATGGCTGG - Intergenic
1138527290 16:57616447-57616469 GGGCACATAGGAGGTGTGGAGGG - Intronic
1139074324 16:63425082-63425104 GGTAAGACAGCAAGGCTGGAAGG - Intergenic
1139480818 16:67229723-67229745 AGGGACAGAGCAGGGTTGGAGGG + Intronic
1139552819 16:67685072-67685094 GGGCACACAGCACCACAGGAAGG - Intronic
1139558138 16:67725606-67725628 GGCCACACAGCAGAGGTAGAGGG - Exonic
1139962031 16:70723697-70723719 AGGCAACCAGCAGGGCTGGTAGG - Intronic
1141238448 16:82242419-82242441 GGGAACCCAGCAGGCGTGGAAGG + Intergenic
1141281700 16:82634975-82634997 GGGCTCACAGCTTGGCAGGAAGG + Intronic
1141444592 16:84049853-84049875 GGGCCCACAGCAGGAGTGGCCGG + Intergenic
1141608069 16:85166883-85166905 GGGCACACTGCAGGGCGGCAGGG - Intergenic
1141688811 16:85585217-85585239 TGACACACAGCAGGGCAGGCAGG - Intergenic
1141886953 16:86898836-86898858 AGTCTCACTGCAGGGCTGGAGGG - Intergenic
1142722630 17:1786858-1786880 AGGCACACAGGATGGCTGCAGGG - Exonic
1143096820 17:4482771-4482793 GGACAGACAGCAGGGCTGGGAGG - Intronic
1143179780 17:4977288-4977310 TGGCCCACAGCAGGGCAGTAGGG - Intronic
1143447945 17:7019837-7019859 CGGGACAGAGCAGGGCTGGCGGG - Intergenic
1143643030 17:8210424-8210446 GCGCACGCCGCAGGGCTGGAAGG - Intronic
1143863735 17:9909233-9909255 GGGCTCACTGCGGGGCTGTAAGG - Intergenic
1143927721 17:10387325-10387347 GGGCACAAAGAAAGGGTGGAGGG - Intergenic
1144942449 17:18951204-18951226 GTGTACACAGCAGGGCTGGCCGG - Intronic
1145269236 17:21395936-21395958 AGCCACACAGCAGGGCAGGCAGG - Intronic
1146296628 17:31655240-31655262 GGGCACACAGACTGGCTGGATGG - Intergenic
1146907834 17:36629503-36629525 GGCCAGAGGGCAGGGCTGGATGG + Intergenic
1147636547 17:41967558-41967580 GGTCCCACAGAAGGGCTGGTGGG - Intronic
1147649109 17:42051824-42051846 TGGCACAGAGCAGTGCTGCATGG - Intronic
1147991101 17:44333989-44334011 GGGCACTCAGGTGGGCTGGCAGG + Intergenic
1148239366 17:45989971-45989993 GGGCACACAGCAGGGCTGGAGGG - Exonic
1148353609 17:46958854-46958876 GGCCACACAGCAAGTCTGGGAGG - Intronic
1148463018 17:47848842-47848864 GGGCTGACAGCAGGTCTGCAGGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149421112 17:56511334-56511356 GGGTACACAGTGGGGCAGGATGG - Intronic
1149660190 17:58330794-58330816 GGGCGCACAGAAGGGCTGGGAGG - Intergenic
1149683287 17:58520298-58520320 GGGCAGTCAGCAGGGATGTAAGG + Exonic
1149867005 17:60156706-60156728 GGGCACTCAGGTGGGCTGGATGG + Exonic
1150329993 17:64286828-64286850 GGGAACACAGCAGGGCCAGTAGG + Intergenic
1150577825 17:66445641-66445663 GGACACACAGCAAGGCCGTAAGG - Intronic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151324761 17:73372284-73372306 GGGCACACTGCTGAGCTGCATGG + Intronic
1151677399 17:75605728-75605750 TGGGAGACAGAAGGGCTGGACGG + Intergenic
1152044676 17:77928122-77928144 GGGCAGACAGGAGGCCTGGATGG + Intergenic
1152281104 17:79385268-79385290 GAGCACCCAGCAGGGCGGGGAGG + Intronic
1152384756 17:79965636-79965658 TGGCCCACAGCAGGGCAGGATGG + Intronic
1152492843 17:80649387-80649409 GGGCAGACAGCAAGACGGGATGG - Intronic
1152631406 17:81412173-81412195 GGGCCCACGGCAGGGCTGGCCGG - Intronic
1152697152 17:81803196-81803218 GGGCACAGAGCAGGGATGGCTGG + Intergenic
1152756955 17:82091043-82091065 GGGCACACAGTGGCGCGGGATGG - Exonic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153957213 18:10107811-10107833 GGACACACTTCAGGGCTGGTTGG - Intergenic
1154298622 18:13173525-13173547 GAGCTCACAGGAGGGCAGGAAGG + Intergenic
1154497941 18:14975969-14975991 GAGGGGACAGCAGGGCTGGAGGG - Intergenic
1155099430 18:22594495-22594517 GGGCAGTCAGCAGGGCATGAGGG - Intergenic
1155158839 18:23179494-23179516 GGGCACACAGCTGGCTTGGAAGG - Intronic
1156257044 18:35408807-35408829 CAGCACACAGCAGGCATGGAGGG - Intergenic
1156360829 18:36383130-36383152 CAGAACACAGCAGGGCTGGAAGG - Intronic
1156449887 18:37260994-37261016 GGGAAGACAGCATGGTTGGAGGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157288674 18:46394509-46394531 GGGCACTCAGCCTGGCTGGGGGG - Intronic
1157773849 18:50374971-50374993 GGGGCCACAGCTGGGCGGGAAGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158943240 18:62425580-62425602 GGGAAAACAGCAGGGAAGGAGGG - Intergenic
1159856568 18:73596459-73596481 AGGCACAGAGCAGGGCAGAAAGG + Intergenic
1160148948 18:76384939-76384961 GGGCACACACCAGAGAGGGAAGG + Intronic
1160392842 18:78548026-78548048 GGGCCCCCGGCCGGGCTGGAAGG - Intergenic
1160680498 19:409820-409842 GGGGACACAGCTGGGACGGAGGG + Intergenic
1160948784 19:1655808-1655830 GCGCACACAGTAGGTGTGGAGGG - Intergenic
1161119700 19:2518528-2518550 GGGCTCAGAGCTGCGCTGGAGGG + Intronic
1161307206 19:3574599-3574621 GGGCGCCGAGCAGGGCTGGCGGG + Intronic
1161327294 19:3670006-3670028 GGGCAGGCAGCAGGTATGGAGGG + Intronic
1161348363 19:3778931-3778953 GGTCATACAGCAGAGCTGGGGGG + Intronic
1161663514 19:5561233-5561255 AGTCACACAGCAGAGCTGAAAGG + Intergenic
1161700735 19:5793646-5793668 GGGGGCACAGCAGGGCTTGGTGG - Intergenic
1161723781 19:5917212-5917234 GGCCCCACAGCAGGGTGGGAAGG + Exonic
1161731047 19:5960822-5960844 GGACACACGGCAGGGCTGAGGGG + Intronic
1161770951 19:6230424-6230446 CAGCACCCAGCAGAGCTGGAGGG - Intronic
1162379371 19:10322725-10322747 GGGCACCCAGGAGGCCTGGAGGG + Exonic
1163715078 19:18868699-18868721 GGGCACGCAGCAGGGCAGGTCGG + Exonic
1165116099 19:33529707-33529729 GGCCACACAGCAGTGCTGCTTGG - Intergenic
1165423970 19:35735636-35735658 GGGCAGGCAGCAGGACAGGATGG - Intronic
1166377275 19:42334508-42334530 GGCCACACAGAGTGGCTGGATGG - Intronic
1166548421 19:43648800-43648822 GGTCACACAGCAAGTCTGTAGGG + Exonic
1167433532 19:49466106-49466128 GGGCCCACAGCAGGGCTGCCCGG - Exonic
1167445225 19:49533646-49533668 CAGCACAGGGCAGGGCTGGAGGG + Intronic
1167618808 19:50550204-50550226 GGGCACAGAGCAGGCCGGGAGGG + Intronic
1167921783 19:52788091-52788113 GGGCTCACACCAGAGATGGATGG - Intronic
1167932024 19:52873747-52873769 GGGCTCACACCAGGCATGGATGG - Intronic
1168110044 19:54187115-54187137 GGGCCCACAGGGAGGCTGGAGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168508003 19:56952500-56952522 GGCCACACAGCAGGACGTGAGGG - Intergenic
925188509 2:1865269-1865291 GTGCAAGCAGCTGGGCTGGAGGG - Intronic
926881011 2:17543325-17543347 GGGAACACAGCAGGGAAAGATGG - Intronic
927174186 2:20393843-20393865 GAGGACACAGCAGGTATGGATGG - Intergenic
927600900 2:24439897-24439919 GGTGACACAGAAAGGCTGGAGGG - Intergenic
927873732 2:26640602-26640624 GGGGCCACAGCAGGGATGAATGG - Intronic
928181380 2:29071155-29071177 GGGCTCACAGGTGGGCTGGGGGG + Exonic
928200553 2:29245279-29245301 CTGCACACAGCAGGGCTCCATGG + Intronic
928200610 2:29245574-29245596 CTGCACACAGCAGGGCTCCATGG + Intronic
928200635 2:29245705-29245727 CTGCACACAGCAGGGCTCCATGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929822076 2:45281817-45281839 GGGCACAGAGCAGCCCTAGAGGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931371643 2:61668803-61668825 GGGCTGAAAGCAGGGCAGGAGGG - Intergenic
932463150 2:71896373-71896395 GGGCACACAGTAATGATGGATGG + Intergenic
932617163 2:73240317-73240339 GGGATCACGGCAGGGCTGAAGGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933993013 2:87647166-87647188 TGGCACCCAGCAGGTCTGCAAGG + Intergenic
934553483 2:95275905-95275927 GGGCAGGCAGCAGGGCATGAGGG - Intronic
934886280 2:98028369-98028391 TCGCACGCAGCAGGGGTGGAGGG - Intergenic
934917593 2:98312499-98312521 GGGGAGGCAGCAGGGATGGAGGG - Exonic
935384679 2:102487890-102487912 AGGCACTCAGCAAGGCTGGCGGG - Intronic
935596170 2:104879667-104879689 GGTCACACAGCAAGGAAGGAGGG - Intergenic
936300844 2:111303713-111303735 TGGCACCCAGCAGGTCTGCAAGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937224566 2:120360828-120360850 GGTCACACAGCATGGCAGGGAGG + Intergenic
937308515 2:120886927-120886949 GGGCTCACGCAAGGGCTGGACGG + Intronic
937312795 2:120912364-120912386 GGGCACCGCTCAGGGCTGGAGGG + Intronic
938143169 2:128812774-128812796 GGGGCCACAGGAAGGCTGGAGGG + Intergenic
938422683 2:131156886-131156908 GGCCACACAGCAGGGACGGCAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940145622 2:150542406-150542428 GAGCCCACAGCAGGTCTGGTGGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
942462607 2:176178641-176178663 GGGCAGGCGGCAGGGCTGGCGGG - Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943700585 2:190984950-190984972 AGGCGCACACCAGGGCTAGAAGG + Intronic
945447463 2:209955151-209955173 GGACACACAGCATGGCAGAATGG - Intronic
946404527 2:219485191-219485213 GTGGAATCAGCAGGGCTGGAGGG + Intronic
947493017 2:230611999-230612021 GGGCACACAGCAGTGATGCAGGG + Intergenic
947720281 2:232365816-232365838 AGGCCTACAGCTGGGCTGGAGGG + Intergenic
947746913 2:232512597-232512619 GGAAACACTGCAGGGCTGGGGGG - Intergenic
948476900 2:238226393-238226415 GTGCGCAGAGCAGGGCTGGCAGG - Intronic
948826444 2:240575464-240575486 GGGGCCTCAGCAGGCCTGGAAGG - Intronic
948915005 2:241030077-241030099 GAGCACACAGCATGACAGGAGGG + Intronic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
1168952807 20:1814122-1814144 GGGCACAGAGGCGGGCTGGCAGG - Intergenic
1169155094 20:3323001-3323023 GCGCTCAGAGCAGGGATGGAGGG - Intronic
1169914659 20:10673461-10673483 GGGCACAGAGCAGGGCGAGCAGG + Exonic
1170005603 20:11665549-11665571 GCGGACACAGCAAGGCGGGAGGG - Intergenic
1171180838 20:23089162-23089184 GGGCACGCAGAAGGACTGCATGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172326902 20:34043131-34043153 GGCCACTGAGCAGGGCTGCAAGG - Intronic
1172502458 20:35437106-35437128 GCCCACACATCAGGGCTGGAGGG - Intronic
1172766650 20:37354722-37354744 GGGCACCCAGAAGGCCTGGTGGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1172974267 20:38894626-38894648 GGGGACACAGCAGGGCTCACAGG - Intronic
1173401406 20:42729429-42729451 GGACACACAGCAGGACTCCACGG - Intronic
1173510312 20:43622932-43622954 GGGCTCTCAGCAATGCTGGAGGG + Intronic
1173658241 20:44715625-44715647 GGTCACACAGCAGGGCTGGCCGG - Intronic
1173874219 20:46359651-46359673 GGGCACTCATCAGGGTTGGCTGG - Intronic
1174048194 20:47748569-47748591 GGACAGAGAGCAGGGCTGGAAGG - Intronic
1174653796 20:52152722-52152744 GGGCACTTGGCTGGGCTGGAGGG + Exonic
1175105456 20:56611589-56611611 GGCCACAGAGGAGGGCAGGAGGG - Intergenic
1175252109 20:57616066-57616088 GAGCTCACAGCAGGGCTGCTTGG - Intronic
1175297547 20:57919448-57919470 TGTCATACAGCAGGGCTGGGAGG - Intergenic
1175819333 20:61900164-61900186 GGGCACGCAGCCAGGCTTGAGGG - Intronic
1175858932 20:62139074-62139096 GGGCACATACCATGCCTGGAAGG - Exonic
1175908165 20:62391996-62392018 GAGCACCCAGCATGCCTGGATGG + Intronic
1176030194 20:63007939-63007961 GGTCACACAGAAGGGCCCGACGG - Intergenic
1176038743 20:63053194-63053216 GGGCCCAGAGCGGGGCTGGAGGG - Intergenic
1176205561 20:63886247-63886269 GGGGACACAGAAGGGCCGGGGGG - Intronic
1176298070 21:5084933-5084955 GGGCATACGCCAGGGCAGGAAGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178535985 21:33410963-33410985 TGGGAAACACCAGGGCTGGAAGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179406647 21:41131899-41131921 GGGCACACTCCAAGCCTGGAAGG + Intergenic
1179858959 21:44177016-44177038 GGGCATACGCCAGGGCAGGAAGG - Intergenic
1179948715 21:44697830-44697852 GGGGACACAGCAGGAGGGGACGG - Exonic
1179971480 21:44838421-44838443 ATGCACAGAGCAGGGCTGGAGGG + Intergenic
1180076933 21:45467769-45467791 GGGCACAGGGCCGGGCGGGAAGG + Intronic
1180819901 22:18819715-18819737 GGGCAGAGAGCAGAGCTGGCAGG + Intergenic
1180954528 22:19735777-19735799 GGGCACACAGCAGGGAGGCGGGG - Intergenic
1181023110 22:20113658-20113680 GTGCCCTCAGCAGGGCAGGAGGG + Intronic
1181173319 22:21022498-21022520 GGCCACACAGGAAAGCTGGAGGG - Intronic
1181206122 22:21254190-21254212 GGGCAGAGAGCAGAGCTGGCAGG + Intergenic
1181591949 22:23890731-23890753 GTGCACACTCCAGGGCTAGATGG + Intronic
1181637601 22:24181601-24181623 GGGGACACAGAAGGGCAGGGAGG - Intronic
1181925575 22:26355945-26355967 GGTCACTCAGCAGAGCTGGAGGG - Intronic
1182072688 22:27474885-27474907 GGACACACAGCAGGGTGTGATGG + Intergenic
1182098563 22:27642154-27642176 AGGAACACAGCAGGGGTCGAGGG + Intergenic
1182352699 22:29707700-29707722 GGGCTCACCCCAGGGCAGGAGGG + Intergenic
1182655238 22:31884806-31884828 GGGGAAACAGCAGGGCTAGCTGG - Intronic
1182713256 22:32335621-32335643 GGACACACAGCTGGGCAGCACGG + Intergenic
1182848616 22:33452273-33452295 GGGGACACAGCAAGGGTGCAGGG + Intronic
1183062048 22:35342274-35342296 GGGCACACAGCAGGCATGTCAGG - Intronic
1183492746 22:38125407-38125429 GGGCACACAACAGGGTAGCATGG + Intronic
1183543433 22:38443100-38443122 GGGCACAGAGGAGCTCTGGAGGG - Intronic
1184432524 22:44449830-44449852 GTGCTCAAGGCAGGGCTGGATGG + Intergenic
1184561991 22:45268787-45268809 GGGCACGCAGCAGTGCTCGCTGG + Intergenic
1184745473 22:46453188-46453210 CTGTGCACAGCAGGGCTGGAAGG + Intronic
1184847805 22:47099910-47099932 TGTCAAACACCAGGGCTGGAAGG - Intronic
1185058608 22:48593824-48593846 GGGTCCACAGCAGGGCAGGAGGG - Intronic
1203220799 22_KI270731v1_random:41238-41260 GGGCAGAGAGCAGAGCTGGCAGG - Intergenic
1203270026 22_KI270734v1_random:45583-45605 GGGCAGAGAGCAGAGCTGGCAGG + Intergenic
949810502 3:8001715-8001737 AGCCACACAGCAGGGATGGCAGG - Intergenic
950259853 3:11535980-11536002 GGGCCCACAGCTGCACTGGATGG - Intronic
950467532 3:13163957-13163979 GGGCACACGCCAGGGCTGAAGGG + Intergenic
950632670 3:14293446-14293468 GGGCACACGGCAGGGAGGGGAGG - Intergenic
950965438 3:17142738-17142760 GAGCCCACAGCAGGGCTGGACGG - Intergenic
951551847 3:23882616-23882638 GAGCCCACTGCAGGGGTGGAGGG + Intronic
952387818 3:32855551-32855573 GGGAACACACTAGGGCAGGAAGG + Intronic
952653742 3:35758631-35758653 TGGCAAACAGCAGGGCTGAAGGG - Intronic
953423087 3:42770050-42770072 GGGCACACAGCGGGACTGGCCGG + Intronic
953714474 3:45306098-45306120 GGGCAGAAAGCAGAGCAGGAGGG - Intergenic
953904024 3:46859242-46859264 GGGGACAGAGCAGGGCAGGAAGG - Intronic
954095899 3:48327513-48327535 GGGAACACAGCAGGCTTGCAGGG + Intronic
954179202 3:48868235-48868257 GGTCACACAGCAGAGTAGGAGGG + Intronic
954181056 3:48881591-48881613 GTGAACACAGCAGGGCTGACAGG + Intronic
954233188 3:49234697-49234719 AGGAACAGAGCAGGGCTGAAGGG - Intronic
954314287 3:49792816-49792838 GGGCCCTCAGCAGGGTGGGAAGG - Intronic
954441471 3:50524626-50524648 GGGCAGAGAGCAGAGCTGGCAGG - Intergenic
954853910 3:53626433-53626455 TGGCACACAGGAGGGCAAGAGGG + Intronic
954864618 3:53718244-53718266 GGGCACACTGCACGCCTGGGAGG - Intronic
954997726 3:54896858-54896880 GGGCACCCACCAGTGCTGAATGG - Exonic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956175536 3:66470015-66470037 GGGTACAAAGCTGGGCTGCAGGG + Intronic
956338843 3:68196750-68196772 GGTCACTCAGCAGGCATGGATGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961652983 3:128426533-128426555 GAGCGCACGGCAGGGCTGGCAGG + Intergenic
962317526 3:134368029-134368051 AGTCAGACAGCAGGGCTAGAGGG + Intronic
962812602 3:138972264-138972286 TGGCTCCCAGCAGGGCAGGAGGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
964090314 3:152868547-152868569 GAGCCCACAGAAGGGCTGGAGGG - Intergenic
964629891 3:158799155-158799177 GGCCACACTGCTGGGCTGAAAGG + Intronic
964731522 3:159871876-159871898 GGGCAGATAGCAGGGCAAGAGGG + Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967104199 3:186242269-186242291 GTGCAGAGGGCAGGGCTGGAGGG - Intronic
967570838 3:191026590-191026612 GTGCACATAGCATGGCTGGGAGG + Intergenic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
968919595 4:3515626-3515648 GAGCACCCAGCAGGGCTGTGAGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969302348 4:6304511-6304533 TGGCACATAGCAGAGCAGGAAGG + Intergenic
969308118 4:6336915-6336937 GGGCTCACAGGAGGGAGGGAGGG - Intronic
969489652 4:7491811-7491833 GGGCACCCATCAGGTCAGGAGGG + Intronic
969860849 4:10034312-10034334 GGGGTCGCAGGAGGGCTGGACGG - Intronic
971244680 4:24917274-24917296 TGGCAGCCAGCGGGGCTGGAGGG - Intronic
971767648 4:30853936-30853958 TGCCACACAGCAGGGCTGCATGG - Intronic
972259237 4:37391793-37391815 GGGAAGACAGCGGGGCAGGAGGG - Intronic
972436941 4:39044460-39044482 GGTCCCTCTGCAGGGCTGGAAGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973226063 4:47786245-47786267 GGGCACTCAGCAGGGCGCGGTGG + Intronic
974074131 4:57153414-57153436 GGGCTGAGAGCAGGGCAGGATGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975573866 4:75843835-75843857 GGGCACAGAAAAGGTCTGGAGGG - Intergenic
976046119 4:80950202-80950224 GGGCACACAAGTGAGCTGGATGG + Intronic
976315732 4:83657044-83657066 GGGGACAGAGTAGGGCAGGATGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977929645 4:102737123-102737145 AGGCACCCAGCAGAACTGGAGGG + Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978637111 4:110822768-110822790 GGGGAGACAGCTGGGCTGGCTGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980979546 4:139642496-139642518 AGACACACTGCAGGCCTGGAAGG - Intergenic
982688173 4:158517662-158517684 GTGCACATAGCAGGTCTGGATGG - Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983534012 4:168838348-168838370 GGGCACAGATGAGGGCTGGGTGG + Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983913283 4:173264449-173264471 GAGCACACAGTAGGGTTAGATGG + Intronic
983918178 4:173314803-173314825 AGGCATACAGCGGGGCTGCAGGG - Intronic
985431141 4:189881528-189881550 GGGCAGACAGCAGAGAAGGACGG - Intergenic
985601640 5:838143-838165 GGGCACTGTGCAGGGCTGCAGGG - Intronic
986200487 5:5574178-5574200 GGGCACAGAGCAGAGCCGGCTGG - Intergenic
986430186 5:7673784-7673806 GGCCTCAGAGCAGGGCTGGGAGG + Intronic
987295844 5:16550593-16550615 AAGCATGCAGCAGGGCTGGATGG - Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988456742 5:31393686-31393708 CAGCAGACAGCAGGACTGGAAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988863506 5:35309026-35309048 CATCACACAGCAGGGATGGAAGG - Intergenic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989043165 5:37249468-37249490 GGCCTGAGAGCAGGGCTGGAGGG - Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990881216 5:60541296-60541318 GGGGCTACAACAGGGCTGGATGG + Intergenic
991447228 5:66713231-66713253 GGGCACACAGCCCACCTGGAAGG + Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992333050 5:75737396-75737418 GGGCACAGAGGAGAGATGGAGGG + Intergenic
992761232 5:79952448-79952470 GGACAGAAAGCAGAGCTGGAGGG - Intergenic
992831334 5:80596354-80596376 GGCCACACAGCAAGGCAGGCAGG + Intergenic
993059824 5:83025845-83025867 GGGCAAAGAACAGGGCTGGCCGG + Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994353774 5:98773600-98773622 GGGCACAGGGCGGGGCGGGACGG + Intronic
994722241 5:103393526-103393548 GGGCAAGCAGCTGGGCTTGAGGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996385766 5:122908904-122908926 GTGCACATAGCAAGGCTGAAAGG + Intronic
997199222 5:131999683-131999705 GGGCACACAGCAGTTCTGTAAGG + Intronic
997200196 5:132005355-132005377 GGGGTCACTGCAGGCCTGGATGG + Intronic
997266113 5:132496330-132496352 GGGCAGCCACCAGGGCTGGGAGG - Intergenic
997453128 5:133999456-133999478 GGGCACAGAGCAGGGTGGAAGGG - Intronic
998482313 5:142473157-142473179 AGGCACACACCAGAGTTGGAAGG - Intergenic
999715745 5:154358617-154358639 GGGCACACAGGAGGAGTGGGAGG - Intronic
1000202341 5:159023882-159023904 GGGCAAACAGGAGGAGTGGAAGG + Intronic
1001133237 5:169081259-169081281 GGGTACACAGCAGGGTGGGAAGG + Intronic
1001223476 5:169924080-169924102 GGGGGCACAGCAGGGCAGGGAGG - Intronic
1001673146 5:173491033-173491055 GGGCACAGAGCAGGGCAGAGAGG + Intergenic
1001679249 5:173544239-173544261 AGACACAGAGCAGGGCAGGAAGG - Intergenic
1001710209 5:173772392-173772414 GGGCAGAAAGGAGGGCAGGAAGG - Intergenic
1002831099 6:822091-822113 GGGCCCAGAGCAGGGCAGAACGG - Intergenic
1003182163 6:3801350-3801372 CGGCACACTGCAGGGCTGGCAGG - Intergenic
1003881327 6:10482701-10482723 GCGCACACCGCCGGACTGGAGGG - Intergenic
1003979758 6:11378525-11378547 GGGCACACAGCAGGCTTTCAGGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005685746 6:28251835-28251857 GGGCCCCGAGCAGGGCTGCAGGG + Exonic
1006176261 6:32123782-32123804 GGGAGCACAGCAGGGAGGGATGG - Intronic
1006373512 6:33659393-33659415 GGGCCCAGAGCAGGGCTGAAGGG - Intronic
1006434641 6:34019878-34019900 GGGCCCACAGCTGGCCTGGGTGG - Intronic
1006497297 6:34432992-34433014 GGTGTCACAGCAGGGGTGGAGGG + Intergenic
1006730216 6:36230785-36230807 TGGCACACAGCAGGCCTGCCAGG - Exonic
1007529272 6:42526596-42526618 GGGCACAGAGCAGGGTGAGAGGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011064093 6:83305647-83305669 GGGGCCACATCAGGGCTTGAGGG + Intronic
1011494317 6:87923591-87923613 TGGCACAAAGCGGGGCAGGACGG + Intergenic
1012038775 6:94176745-94176767 GGGCACACAGGAGACATGGAAGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013227889 6:108133871-108133893 GGCCCCACCGCACGGCTGGAGGG + Intronic
1013428265 6:110034257-110034279 GGGCCCGCAGCAGGGAAGGAAGG - Intergenic
1013480883 6:110551583-110551605 GGGCACAAAGAAGAGCTGCAGGG - Intergenic
1013507348 6:110814402-110814424 GGGCATACAACAGGGATGGGAGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014211225 6:118710237-118710259 GGACACACTGCAGCACTGGAGGG + Intergenic
1014252471 6:119128735-119128757 TGGCAGATAGCAGGCCTGGAAGG + Intronic
1014808565 6:125859193-125859215 GGGCACACAGCAGCATTTGATGG + Intronic
1016112803 6:140246696-140246718 GGGCACACCGCAGGACTTGCAGG + Intergenic
1016361590 6:143273463-143273485 GGGGACACAGCAGAGGTGAATGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017097463 6:150817311-150817333 GGGCACACAGAAGAGATGGGAGG + Intronic
1018042752 6:159939729-159939751 GGGTGAACAGCAGGGCTGGCAGG + Intergenic
1018462870 6:164015704-164015726 GGCCATACAGCAGGGCTGTCTGG - Intergenic
1018576557 6:165265960-165265982 TGCCACACAGCTAGGCTGGATGG - Intergenic
1018889737 6:167975305-167975327 CTGCATACAGCAAGGCTGGAGGG + Intergenic
1018992842 6:168687166-168687188 GGGAGCACAGCAGGGGAGGAGGG - Intergenic
1019323004 7:424155-424177 GGGCATCCTGCAGGGCGGGATGG - Intergenic
1019354200 7:570438-570460 GGGGACACAGGAGCGCGGGAGGG - Intronic
1019452350 7:1106356-1106378 GGGCCCTCAGAAGCGCTGGAAGG - Intronic
1019480004 7:1261988-1262010 GGGCCCACAGCGCTGCTGGATGG - Intergenic
1019557520 7:1640059-1640081 TGGCACCCAGCAGGGCCGGGGGG + Intergenic
1019695934 7:2446170-2446192 GAGCCAGCAGCAGGGCTGGAAGG + Intergenic
1019732040 7:2633845-2633867 AGGCACCCCGGAGGGCTGGAAGG - Intronic
1021885194 7:25130962-25130984 GGCCACAGAGCAGGGATTGAGGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023186636 7:37539532-37539554 GGACAAACATCAAGGCTGGAGGG + Intergenic
1023421639 7:39986050-39986072 GGGCACAGAGTAGGGCAGAAAGG + Intronic
1023840905 7:44097013-44097035 AGGCTCACCCCAGGGCTGGAGGG + Intergenic
1024016904 7:45325513-45325535 GCTGACACAGCAGGACTGGAAGG + Intergenic
1024557403 7:50615384-50615406 GGCCACACAGCAGAGCTGGGAGG + Intronic
1024951248 7:54862927-54862949 AGGCAGACAGAAGGGCTAGAGGG + Intergenic
1025017342 7:55449761-55449783 GGGCACAGTGCGGGGGTGGAGGG - Intronic
1025213169 7:57032941-57032963 GGGCTCACAGCAGCACTGGCAGG + Intergenic
1025658784 7:63543883-63543905 GGGCTCACAGCAGCACTGGCAGG - Intergenic
1026653127 7:72233253-72233275 GGACCCACTGCAGGGTTGGAAGG + Intronic
1026991134 7:74586471-74586493 GGGCACGCAGGGGGGCTGGCGGG + Intronic
1027824085 7:83088545-83088567 TGGTACACAGAAGGGCTGGTGGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029113790 7:98226503-98226525 GGACACACAGTATGGCTGGAAGG + Intronic
1029515476 7:101020640-101020662 GGGCACACAGCAGGGTGTGCTGG - Intronic
1029708051 7:102285927-102285949 GGGGGCTCAGCAGGCCTGGAAGG - Intronic
1030082896 7:105792479-105792501 GGGGACAAAGCAGGGAGGGAGGG + Intronic
1030292719 7:107888205-107888227 GGGCACACAGCGGGACTGGCGGG + Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032078556 7:128847647-128847669 GGGGACCCATCAGGGCTGGTGGG + Intronic
1032089427 7:128903907-128903929 GGGCACAGGGCAGGGATGGAGGG + Intronic
1032515313 7:132502326-132502348 ATGCACACAGCAGGGCAGGAAGG + Intronic
1033105065 7:138513247-138513269 GGGCACACAAGAAGGCAGGAAGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034271530 7:149805560-149805582 GGGCATACAGGGGGGCTGCAGGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035213398 7:157346015-157346037 GGGCCCTCAGGAGGACTGGAAGG - Intronic
1035314299 7:157988635-157988657 GGGAGCACAGGGGGGCTGGAGGG + Intronic
1035358256 7:158292618-158292640 CGCCACACACCTGGGCTGGATGG + Intronic
1035563939 8:628854-628876 GGGCACACAGCAGGGGAGCTGGG - Intronic
1035596933 8:865861-865883 CGGCTCACAGCAGGGCAGTAGGG + Intergenic
1035655812 8:1303839-1303861 AGGCACCCTGCAGGTCTGGATGG + Intergenic
1035685318 8:1519858-1519880 GGGCACAGAGCAGGGGAGCATGG + Intronic
1036654549 8:10669586-10669608 GTGCCCACTGCAGGCCTGGATGG - Intronic
1036902331 8:12679609-12679631 CCTCACACTGCAGGGCTGGAGGG + Intergenic
1037689248 8:21168903-21168925 GGGCCCACAGGAAGGCTGCACGG + Intergenic
1038347841 8:26748351-26748373 AGAAAAACAGCAGGGCTGGACGG - Exonic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041395106 8:57381752-57381774 GGGCACATAGCATTGCTCGAAGG + Intergenic
1041660584 8:60397551-60397573 GGGCAGACGGCTGGGCTGGTGGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042939845 8:74096555-74096577 GGAGAGTCAGCAGGGCTGGAGGG - Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046954116 8:120045889-120045911 GGGCAGTCAGCAGGGCTGTCTGG - Intronic
1047124828 8:121948464-121948486 AGGCACACAGGAGGACTGGCAGG + Intergenic
1047131410 8:122024506-122024528 GGTCACATTGCATGGCTGGATGG - Intergenic
1048559288 8:135515497-135515519 GGGCACAGAGCAGAGTAGGAAGG - Intronic
1048581207 8:135731165-135731187 GGGCACACTGAAGGGTTGGTAGG + Intergenic
1049070012 8:140349138-140349160 GGGCACACAGCGGGGGCCGATGG + Intronic
1049070089 8:140349376-140349398 GGGCACACAGCGGGGCCGATGGG + Intronic
1049070101 8:140349413-140349435 GGGCACACAGCGGGGCCGATGGG + Intronic
1049070115 8:140349450-140349472 GGGCACACAGGGGGGCCGAAGGG + Intronic
1049086274 8:140480787-140480809 GGGCCCACAGCAAGGCGGGGAGG - Intergenic
1049358976 8:142202873-142202895 GGGCACAGAGCAGGGCAGGGAGG - Intergenic
1049429039 8:142550757-142550779 GTGCACACTGCAAGGCAGGAGGG - Intergenic
1049508926 8:143018261-143018283 GCGCGCACAGCAGGGCCGGGTGG + Intronic
1049564353 8:143330546-143330568 GGGCCCACGGGAGGGCTGGTGGG + Intronic
1049601365 8:143509348-143509370 GAGCCTGCAGCAGGGCTGGAAGG - Intronic
1049611063 8:143555543-143555565 GGGCACACAGCATCCCTGCAAGG - Intronic
1049861697 8:144902849-144902871 TGGCACACAGAAGTGCTGGCGGG + Intergenic
1050113680 9:2241902-2241924 TTGCACACACCAGGGGTGGAGGG - Intergenic
1050741582 9:8826467-8826489 GGGAGGCCAGCAGGGCTGGAGGG - Intronic
1052839711 9:33281981-33282003 AGGCACCCAGCTAGGCTGGAGGG - Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053417876 9:37958200-37958222 GGGCACACAGGAGGGCAGCGAGG + Intronic
1056038752 9:82637653-82637675 GGGCACAAAGCTGGGTTGGGTGG - Intergenic
1057143868 9:92745546-92745568 GGGCCCACATCAAAGCTGGAGGG - Intronic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1058918357 9:109589101-109589123 GAGAACACACCAGGGCTTGAGGG + Intergenic
1060347262 9:122828139-122828161 GGGGACACAGCAGCGGCGGAGGG + Intronic
1060803384 9:126558594-126558616 GGGCAGGCAGCCGGGCTGGTGGG - Intergenic
1061160730 9:128892482-128892504 GGGGAGACGCCAGGGCTGGAGGG - Intronic
1061368077 9:130182823-130182845 AGGCACAGGGCAGGGCAGGATGG - Intronic
1061392689 9:130326638-130326660 GGGAACACGGGAGGGCTAGATGG + Intronic
1061426542 9:130501954-130501976 GGGCACAGAGCAGGTGTAGAAGG + Intergenic
1061482943 9:130906118-130906140 GGGCACAGAGCCGGCCTAGAGGG - Intronic
1061489320 9:130936509-130936531 GGGCAGACAGCTGGGCTGTGTGG + Intronic
1061521515 9:131120955-131120977 GGCCAGAGAGCAGGACTGGAGGG - Exonic
1061728715 9:132596859-132596881 GGGGAGACAGCAGAGCTGCAGGG + Intronic
1062048334 9:134434666-134434688 GGGCCCACAGCCGGGCAGGGGGG - Intronic
1062091171 9:134679512-134679534 GGGGGCACTGCAGGGCTGGTTGG + Intronic
1062343473 9:136103999-136104021 GGGAACTCGGAAGGGCTGGAGGG + Intergenic
1062343550 9:136104341-136104363 GGGCAGGCTGCAGGGGTGGAGGG - Intergenic
1062386009 9:136311823-136311845 CTGCCCACAGCAGGGCTGGGGGG - Intergenic
1062395931 9:136352808-136352830 GGGCACACTGGAGGGCTGTGTGG - Intronic
1062698566 9:137887736-137887758 GGGGACAAAGAAGGGGTGGATGG - Intronic
1185469123 X:372041-372063 GGCCCCACTGCAGGGCTGAAGGG + Intronic
1185791056 X:2928641-2928663 GGGAACACGGCCGTGCTGGAAGG + Intronic
1186451860 X:9680569-9680591 AGGCAAGCAGGAGGGCTGGATGG - Intronic
1186484337 X:9922448-9922470 GGTCACACATCAGGGAGGGATGG - Intronic
1186578350 X:10790392-10790414 GGGCACACAGCAGGGGAGAGAGG - Intronic
1187245210 X:17547816-17547838 GCTGACTCAGCAGGGCTGGAAGG + Intronic
1187372927 X:18725542-18725564 AGGCAGACTGCAAGGCTGGAGGG - Intronic
1187724000 X:22183279-22183301 GGGCAGAGAGCAGGGATGGCCGG - Intronic
1188614254 X:32137844-32137866 GGGGACATAGCAGGGTTGGCAGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192166096 X:68828618-68828640 GGGCACAGAGCAGGACTTCAGGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194025534 X:88746348-88746370 GGGCACACGGCGGGACTGGCAGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197155639 X:123266963-123266985 GGACACACAGCAGGGCTAAGGGG - Intronic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198765435 X:140075210-140075232 GGTCAGACAGCAGGGCTCCAGGG + Intergenic
1198771793 X:140138412-140138434 GGTCAGACAGCAGGGCTCCAGGG + Intergenic
1200074729 X:153545257-153545279 CGGCACACAGCAGCCCTGCAAGG - Intronic
1200215887 X:154368116-154368138 GGGCACACGGCTGTGCGGGAGGG + Intronic
1202297518 Y:23375920-23375942 GTGGCCACAGCAGGGCTGGGTGG + Intergenic
1202573291 Y:26294677-26294699 GTGGCCACAGCAGGGCTGGGTGG - Intergenic