ID: 1148240008

View in Genome Browser
Species Human (GRCh38)
Location 17:45994062-45994084
Sequence GAACCCTGCATTGCAGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148240008_1148240012 3 Left 1148240008 17:45994062-45994084 CCCTTTTCTGCAATGCAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1148240012 17:45994088-45994110 CAGGGTTCGCAGCCTGAAGATGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148240008 Original CRISPR GAACCCTGCATTGCAGAAAA GGG (reversed) Intronic
901278745 1:8014345-8014367 GGCCACTGCTTTGCAGAAAATGG - Exonic
904412189 1:30331216-30331238 GCACACACCATTGCAGAAAAAGG - Intergenic
904969006 1:34404421-34404443 AAACCCTGTATTGCAGTGAATGG - Intergenic
905677192 1:39834952-39834974 GAACGCTGCTATGCAGAACAAGG + Intergenic
907592826 1:55691874-55691896 GCACCCTGCCTTCCAAAAAAGGG - Intergenic
908008688 1:59753397-59753419 GAGCCCTGCCTTTCAGGAAAGGG + Intronic
910467384 1:87514912-87514934 GGAGCCTGCATTCTAGAAAATGG - Intergenic
911338611 1:96610460-96610482 GAACGCTGCATTACTGCAAATGG - Intergenic
911858878 1:102920360-102920382 GGTCCCTGCAGTGTAGAAAAAGG + Exonic
912219784 1:107660183-107660205 GAACCCTGCAATGCTCAGAAAGG + Intronic
915819533 1:159007146-159007168 GAACCATGCATTTCAGATAATGG - Intronic
917510842 1:175668143-175668165 GAATCCTGCCTTGTAGAAATGGG + Intronic
920539506 1:206767502-206767524 GAATTCTGCATTTCAGAGAAAGG - Intergenic
921188579 1:212690574-212690596 GAACACTGAATAGCAGCAAAGGG + Intronic
923860154 1:237885179-237885201 GAACCCTACAGTGGAGAAACAGG - Exonic
924786184 1:247202169-247202191 AGGCCCTGCAGTGCAGAAAAGGG + Intergenic
1064222690 10:13455413-13455435 GCACGCTGCATTGCAGAAGAGGG + Intronic
1064365016 10:14699802-14699824 GAAGCCTGCAATGGAGCAAAAGG + Intronic
1067392862 10:45881209-45881231 GAACCCTGAATTTCAGATGATGG - Intergenic
1067861184 10:49850332-49850354 GAACCCTGAATTTCAGATGATGG - Intronic
1067980906 10:51083248-51083270 GAACCCTGGCTGGCAGGAAAGGG - Intronic
1073092036 10:100949906-100949928 AAACCCTGAATTGCTTAAAAAGG - Intronic
1074850598 10:117436547-117436569 GATCCCTGCCTTGCAGGGAAGGG + Intergenic
1075547880 10:123369060-123369082 GAGCCCCACACTGCAGAAAAAGG - Intergenic
1075644914 10:124091291-124091313 GAACCCTCCCTTCCAGAACATGG - Intronic
1078851539 11:15168579-15168601 GCACACTGCATGGCACAAAAGGG - Intronic
1081680684 11:45000261-45000283 AGACCCTGAATTTCAGAAAAAGG + Intergenic
1085428269 11:76424057-76424079 GAGCCAGGCATTTCAGAAAATGG - Intergenic
1091035696 11:132231228-132231250 AAACTCTGCATTAGAGAAAATGG - Intronic
1093008484 12:14078444-14078466 AAAGCCTGCATAGAAGAAAAAGG - Intergenic
1093900959 12:24631562-24631584 GTTGCCTGCAGTGCAGAAAAGGG - Intergenic
1093913625 12:24775227-24775249 GAAGCTTGCATTCCAGCAAAGGG - Intergenic
1097902722 12:64889427-64889449 GATCCCTGCATTGGACAGAAAGG - Intergenic
1098429054 12:70399506-70399528 AAAAGCTGAATTGCAGAAAATGG + Intronic
1100017498 12:90028504-90028526 AAACCCTGAAATGCATAAAATGG - Intergenic
1100128245 12:91456830-91456852 GAACACTGAAATGCAGAAAGAGG - Intergenic
1104228458 12:126860207-126860229 CATCTCTGCAGTGCAGAAAATGG - Intergenic
1108463263 13:50689198-50689220 GAAGGCTCCATTGCAGCAAAAGG - Intronic
1108716155 13:53080151-53080173 GAACCCTACACTGAAGGAAATGG - Intergenic
1110694005 13:78465889-78465911 GAGGCCAGCATTGTAGAAAAAGG + Intergenic
1110832248 13:80044898-80044920 GTATCCTTCATTTCAGAAAATGG + Intergenic
1111704913 13:91736806-91736828 GAATCCTCTATTCCAGAAAATGG + Intronic
1112726094 13:102306474-102306496 GAACAGAGCATTACAGAAAAAGG + Intronic
1115977313 14:39011382-39011404 GGATCCTGCAGTGCAGACAACGG - Intergenic
1116683824 14:48012105-48012127 GAAACATGCATGGAAGAAAAAGG + Intergenic
1120087559 14:80291718-80291740 AAAGCCTTCATTGAAGAAAATGG - Intronic
1120966985 14:90176176-90176198 GAAGTCTGCATTGCAGACATGGG + Intronic
1121947459 14:98136853-98136875 GAATTCTGCTTTGCAAAAAAAGG - Intergenic
1122107562 14:99470130-99470152 GATAGCTGCATTCCAGAAAAAGG - Intronic
1124247899 15:28086167-28086189 CATCCCTGCCCTGCAGAAAAGGG + Intronic
1125127430 15:36240466-36240488 TAACTCTGTATTCCAGAAAATGG - Intergenic
1125267585 15:37900924-37900946 GAAACCTGCAGTGGGGAAAAAGG - Intergenic
1129698899 15:77756175-77756197 GGACCCTGCAGTGAAGAAAGTGG - Intronic
1132199887 15:99944087-99944109 GCACCCTGCATTCCAGCAAATGG - Intergenic
1135428510 16:22361279-22361301 GAAATCTACATTACAGAAAAGGG - Intronic
1137329478 16:47477145-47477167 GAAACCTGAAATGCAGAGAAGGG - Intronic
1138906895 16:61347352-61347374 GAAAGCTGAATGGCAGAAAACGG - Intergenic
1144514750 17:15909666-15909688 GAACCCTGCAAAGCAGACACAGG - Intergenic
1145732904 17:27206094-27206116 GCACCCTGCAAAGCTGAAAAAGG - Intergenic
1146279745 17:31537434-31537456 GAGCCTTGCATTCCAGAAAAGGG + Exonic
1148240008 17:45994062-45994084 GAACCCTGCATTGCAGAAAAGGG - Intronic
1152350378 17:79780974-79780996 AAAGCCTGTATTTCAGAAAAGGG - Intronic
1152495446 17:80668077-80668099 GAAACCTGCACTGAAGAACAGGG - Intronic
1155380939 18:25221301-25221323 AAACCCTGCAATCCAAAAAATGG - Intronic
1157520075 18:48339350-48339372 ACACCCAGCATTGCAGACAAGGG + Intronic
1161336320 19:3715686-3715708 GCACCCTGCATTGCCCAGAATGG - Intronic
1161412232 19:4123310-4123332 GGTCCCTGCAGTGCAGAAGATGG - Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1166469850 19:43070895-43070917 GAGCTCTGCATGGCAGGAAAAGG - Intronic
1167406398 19:49311373-49311395 GAACCCTCCCTTGCAGAAGCGGG - Exonic
925468532 2:4134099-4134121 GAACCCTACAGTGCACAAGATGG + Intergenic
925976409 2:9145198-9145220 AAACTCCGGATTGCAGAAAATGG - Intergenic
927603956 2:24469653-24469675 GGACCCTTCATTCCAAAAAAAGG - Intergenic
932108789 2:68974125-68974147 GAGCTCAACATTGCAGAAAAGGG + Intergenic
935264931 2:101386525-101386547 GAAATCTGCATTTAAGAAAATGG - Intronic
936698732 2:114984299-114984321 GAACCCTGGTTTGCAGAATGGGG + Intronic
936725319 2:115307751-115307773 GAACGTTGCATTCCAGATAAGGG + Intronic
938024184 2:127931236-127931258 GAACACCTCATTGCAGAAATAGG - Intergenic
941035774 2:160567761-160567783 GAAGCCTGGATTGTGGAAAAAGG - Intergenic
941473056 2:165913858-165913880 GTTACCTGCATTTCAGAAAATGG - Intronic
941648112 2:168063926-168063948 AAACCCTGCAATGCAGAGGAAGG + Intronic
945300751 2:208214158-208214180 TAACTCTGAATTGCAGTAAAGGG - Intergenic
945401858 2:209392120-209392142 TAACACTACATTGTAGAAAAAGG - Intergenic
947051728 2:226052005-226052027 GAACTCTGCATTCCAGGAATAGG - Intergenic
1169734352 20:8821954-8821976 GAACCAAGAACTGCAGAAAAAGG - Intronic
1173972516 20:47163731-47163753 CTACCCAGCAGTGCAGAAAAAGG - Intronic
1174678462 20:52380718-52380740 GAACCTTGCATATCATAAAATGG - Intergenic
1175137647 20:56836835-56836857 GAACCCTGCCTTGCTGAGCAGGG + Intergenic
1175702762 20:61152331-61152353 AAAGCCTGCATTGCTGTAAATGG - Intergenic
1176766474 21:13024023-13024045 GCACGCTGCACTGCGGAAAATGG + Intergenic
1178174318 21:30078619-30078641 GAAGGCTGCTTTTCAGAAAAGGG - Intergenic
1178177952 21:30126640-30126662 CAACCTGCCATTGCAGAAAAAGG - Intergenic
1179287459 21:39990270-39990292 GAAACCTGCTTTGTAGCAAATGG + Intergenic
1180985796 22:19903356-19903378 GAGCCCTGCTTTGCAGAAAGCGG + Intronic
954457800 3:50609423-50609445 GGACCCTTTATTGCGGAAAAGGG - Intronic
956087316 3:65626064-65626086 AAACCCTACATTGCAGGCAATGG - Intronic
957429165 3:80079167-80079189 GAAACCTTCATTCCTGAAAAAGG - Intergenic
959563475 3:107809660-107809682 GAACAATGTATTGCTGAAAATGG + Intronic
959784454 3:110276820-110276842 AAACCCTGTCTTTCAGAAAAAGG - Intergenic
960054106 3:113264520-113264542 GAAACCAGCTTTGCAGACAAAGG + Intronic
965842184 3:172918978-172919000 GAAACATTCATTGCAAAAAAGGG + Intronic
971242908 4:24904824-24904846 AAACCCTGCACTGAAGAAGAGGG - Intronic
975450960 4:74526141-74526163 GATCTCTGCATTGAAGATAAGGG - Intergenic
975498832 4:75062678-75062700 GAACCCAGAGTTGCAGAGAAGGG + Intergenic
977542513 4:98334545-98334567 CACCCCCGCATGGCAGAAAAAGG + Intronic
978767528 4:112419688-112419710 GTATCCTGCATGGCTGAAAATGG + Intronic
980446156 4:132910580-132910602 GATCCCTGCATTGCACTAACTGG + Intergenic
981413867 4:144464933-144464955 AAACCCTGAAAAGCAGAAAAAGG + Intergenic
982119062 4:152122539-152122561 GAACCCAGCAATACATAAAAAGG - Intergenic
986285980 5:6359449-6359471 GAGCCCTCCATTACAGAAACTGG - Intergenic
989206788 5:38817121-38817143 GAAACCTGCCTTCCAAAAAAAGG - Intergenic
990204208 5:53411657-53411679 GATCCCTGAATAGTAGAAAATGG + Intergenic
991442427 5:66664727-66664749 GAAACCTACAATTCAGAAAATGG + Intronic
993596439 5:89862540-89862562 GAACCCTGCATTGTGGACATTGG + Intergenic
994825557 5:104709414-104709436 GATCCAAGCACTGCAGAAAATGG + Intergenic
996895682 5:128479335-128479357 CTACCCTGCATTGCTGATAAAGG - Intronic
999045011 5:148457550-148457572 GAACACTGCCTTGCAGGAGAAGG - Intronic
999385343 5:151150349-151150371 CAACCCTACAAAGCAGAAAAGGG - Intronic
999824043 5:155257342-155257364 GAACCAGGCATTCCAGAAATAGG - Intergenic
1003212831 6:4082444-4082466 GTAACCTGCATTGGAGAAGAGGG - Intronic
1003693220 6:8375580-8375602 GAAACCAACATTGAAGAAAATGG - Intergenic
1004815067 6:19303847-19303869 TAAACCTCCATTACAGAAAAGGG + Intergenic
1007015673 6:38464412-38464434 GAACCCAGCAATCCATAAAAAGG - Intronic
1007997264 6:46321629-46321651 GAAGCCACCATTGCAGAGAAGGG + Intronic
1009894458 6:69730261-69730283 GAAACCAGCATTCCAGATAAAGG - Intronic
1010963626 6:82177064-82177086 GAAGACTTCATTGCAGAAGAAGG - Intronic
1014580668 6:123133367-123133389 GAGCCCTGTATTCCAGAAAGAGG + Intergenic
1015449612 6:133350197-133350219 GAACACTGCATGGCACATAATGG - Intronic
1016720042 6:147285960-147285982 GAACTCTGCATGGTAGAAAGAGG + Intronic
1017187536 6:151617115-151617137 GCACCCTCCATTTTAGAAAAGGG - Intronic
1017901991 6:158726391-158726413 GAACACCTCATTGCAGAAACAGG + Intronic
1022057182 7:26750100-26750122 GAACATAGCATTTCAGAAAATGG - Intronic
1022137227 7:27459981-27460003 GAATTCTGCATTGAAGATAATGG + Intergenic
1023415243 7:39925932-39925954 CAACCCTGTATTGAAGACAATGG + Intergenic
1023887240 7:44367998-44368020 GCACCCTGCATCCCAGGAAATGG + Intergenic
1024363776 7:48497946-48497968 GAACCCAGAAGTGCAGAATACGG - Intronic
1024996319 7:55275470-55275492 GAACCCTGCAGTCCAGAAGAGGG - Intergenic
1025959354 7:66206096-66206118 GAATCCGGCATTGCAGAGAGTGG - Intronic
1027734452 7:81914918-81914940 AAACCTTGCATTACAAAAAAGGG - Intergenic
1031228394 7:119071961-119071983 GAACCCTCCAGTGTAGAAAATGG - Intergenic
1031544490 7:123034892-123034914 GAACCCAGAATTGCAGGAACAGG - Intergenic
1031600866 7:123707574-123707596 GAACCTTGCATTTCTGAATAGGG - Intronic
1032747109 7:134796939-134796961 AAACCCTACAGTGCTGAAAAGGG + Intronic
1033620634 7:143059173-143059195 GAACCATGCAGTGAAGAAAGGGG + Intergenic
1033620689 7:143059754-143059776 GAACCATGCAGTGAAGAAAGGGG + Intergenic
1037011206 8:13845025-13845047 GACCTCTGAATTGAAGAAAAAGG + Intergenic
1037321334 8:17646131-17646153 GAAAGCTGCCTTGAAGAAAAAGG + Exonic
1039682087 8:39751437-39751459 AAACACTTCATTGCAGAAAAAGG - Intronic
1041556097 8:59158311-59158333 GAACTCCACATTACAGAAAATGG + Intergenic
1042045958 8:64651896-64651918 TATCTCTGCTTTGCAGAAAAGGG - Intronic
1042090821 8:65157669-65157691 GAACCTGGAAATGCAGAAAATGG + Intergenic
1043107389 8:76131937-76131959 GAACCCTGTATTCAATAAAATGG - Intergenic
1048708148 8:137177812-137177834 GAAGCATCCAGTGCAGAAAAGGG - Intergenic
1049955965 9:693333-693355 TAACCCTCCACTGCAGAGAAAGG - Intronic
1051647734 9:19286751-19286773 GAACTCTGCATGGCAGGAAGGGG - Exonic
1051679999 9:19597497-19597519 GTGCCCTGCATTACAGAATAGGG + Intronic
1053362784 9:37501234-37501256 AAAGGCAGCATTGCAGAAAAGGG + Intronic
1055750820 9:79502861-79502883 GAACCATGCTTTGCAAAAGATGG + Intergenic
1056803972 9:89713623-89713645 GATCCCTGACTTGCAGAAACTGG - Intergenic
1057970428 9:99551976-99551998 GAACAATGCATGGAAGAAAAAGG + Intergenic
1059145912 9:111898916-111898938 GAACAGTGCCTTGCACAAAACGG - Intronic
1059395521 9:114031954-114031976 AAACCCTGCAATGCAGAGATAGG - Intronic
1062131326 9:134895136-134895158 GGGCCCTGCATTGCAGCACAAGG + Intergenic
1187249256 X:17582185-17582207 AAACCCAGCATTGGAGAAATGGG + Intronic
1187958360 X:24543144-24543166 GCTCACTGCATTCCAGAAAAAGG - Intergenic
1188304503 X:28546121-28546143 GAACCCTGAACTGCTGTAAAAGG + Intergenic
1192685063 X:73295293-73295315 GAACTCTGCACTGGAGCAAATGG + Intergenic
1195346652 X:103956762-103956784 GAACTCTGCATTGGATCAAATGG + Intronic
1195360790 X:104082079-104082101 GAACTCTGCATTGGATCAAATGG - Intergenic
1195911166 X:109889863-109889885 GAAGCCTGCTTTGCAGCAGAGGG - Intergenic
1200175592 X:154113646-154113668 TAGACCTGCATTGCAGGAAATGG - Intergenic