ID: 1148241239

View in Genome Browser
Species Human (GRCh38)
Location 17:46000631-46000653
Sequence TGCACACTAGAGTCACCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148241239_1148241245 3 Left 1148241239 17:46000631-46000653 CCCCTGGGTGACTCTAGTGTGCA 0: 1
1: 1
2: 2
3: 28
4: 174
Right 1148241245 17:46000657-46000679 TGGCTGAGACTCAGTGGCCCTGG 0: 1
1: 0
2: 2
3: 27
4: 333
1148241239_1148241246 4 Left 1148241239 17:46000631-46000653 CCCCTGGGTGACTCTAGTGTGCA 0: 1
1: 1
2: 2
3: 28
4: 174
Right 1148241246 17:46000658-46000680 GGCTGAGACTCAGTGGCCCTGGG 0: 1
1: 0
2: 2
3: 33
4: 279
1148241239_1148241243 -3 Left 1148241239 17:46000631-46000653 CCCCTGGGTGACTCTAGTGTGCA 0: 1
1: 1
2: 2
3: 28
4: 174
Right 1148241243 17:46000651-46000673 GCAGCCTGGCTGAGACTCAGTGG 0: 1
1: 0
2: 3
3: 21
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148241239 Original CRISPR TGCACACTAGAGTCACCCAG GGG (reversed) Intronic
900726007 1:4216708-4216730 TGGACATTAGAATCGCCCAGGGG + Intergenic
900851242 1:5144690-5144712 TGCACTTTAGAGTCACCTATTGG - Intergenic
901087859 1:6622611-6622633 GGCACACAAGAGTCACCCAACGG - Exonic
902931321 1:19733562-19733584 TGCACACCAGAATTGCCCAGGGG + Intronic
903704749 1:25277465-25277487 TGCACAGAAGAATCACCAAGAGG - Intronic
903722483 1:25415859-25415881 CGCACAGAAGAATCACCCAGAGG + Intronic
905338143 1:37259567-37259589 TGCACATTAGAATCACCTGGGGG - Intergenic
905439465 1:37985388-37985410 TGCACATTAGAATCACCTGGGGG + Intronic
905516511 1:38565794-38565816 TGAACACTAGAATCACCCTCAGG + Intergenic
905785500 1:40753692-40753714 TGCACACTAGAATCACCTGTTGG + Intronic
907093657 1:51753928-51753950 TGCACATTAAAACCACCCAGGGG - Intronic
920251667 1:204626104-204626126 TGCCGAGTAGAGTGACCCAGGGG - Intronic
920292508 1:204933667-204933689 AGAACACTAGATTCAGCCAGTGG + Intronic
920893256 1:210015238-210015260 TGAACACTGGAGTTATCCAGAGG - Intronic
923077852 1:230625613-230625635 TGCACACCACAGGCAGCCAGTGG + Intergenic
923099450 1:230800785-230800807 TGCACACTGGACTCACCAAGGGG - Intronic
1063456934 10:6190275-6190297 TTCACACAAGAATCACCGAGTGG - Intronic
1066706665 10:38187291-38187313 TGTACACTAGACAAACCCAGTGG - Intergenic
1067932897 10:50581221-50581243 TGCACATTAGAATCACCCTGAGG - Intronic
1068746050 10:60531905-60531927 TGAACATTAGAGTCACCAGGAGG - Intronic
1070665330 10:78338601-78338623 TGCAGACCACAGGCACCCAGGGG - Intergenic
1072523948 10:96254922-96254944 TGCACATTAGAATCACTTAGGGG + Intronic
1075104841 10:119532256-119532278 TGCAAACTCCACTCACCCAGTGG + Intronic
1076215115 10:128687118-128687140 TGCACTCTTGGGTCAGCCAGGGG + Intergenic
1078350881 11:10592165-10592187 TGCACATTAGAATCACCTGGGGG + Intronic
1079034587 11:17011237-17011259 ATCTCACTAGCGTCACCCAGGGG - Intronic
1080777758 11:35402143-35402165 CGCACACCAAAGTCACCCAAAGG - Intronic
1083961504 11:66017236-66017258 TGCACCCCAGAACCACCCAGAGG + Intronic
1086143389 11:83523882-83523904 TGCCCATTAGAGTCAGCCAGTGG + Intronic
1087084057 11:94198649-94198671 TGCACACTAGTGTTTCCCAGAGG + Intergenic
1088113487 11:106289190-106289212 TGCACAGTATACTTACCCAGTGG + Intergenic
1088630566 11:111770274-111770296 TGCACACTAGAATCACCCAGTGG - Intergenic
1089767870 11:120781672-120781694 TGCCCATCAGAGTCACCTAGAGG - Intronic
1090393391 11:126403951-126403973 TGCACTTTAGAATCACCCAGCGG + Intronic
1091074435 11:132601880-132601902 TGCACACTACAGTTACACAGGGG + Intronic
1092350257 12:7750433-7750455 TCCAAACCAGAATCACCCAGTGG - Intronic
1094182547 12:27607500-27607522 TGCACATTAGAATCACCTGGAGG + Intronic
1095656779 12:44679394-44679416 TGCACAGTAGAATTACCAAGCGG + Intronic
1099300869 12:80892860-80892882 TGCATATTAGAATCACACAGGGG - Intronic
1101299686 12:103466351-103466373 TGCTCATCAGAGTCTCCCAGAGG + Intronic
1101865519 12:108517044-108517066 TGCTCAGCAGCGTCACCCAGAGG - Exonic
1101956844 12:109219376-109219398 TGTACATTAGAATCACCTAGGGG + Intronic
1104662823 12:130623852-130623874 TGTACACCACAGTCTCCCAGAGG + Intronic
1106406533 13:29479692-29479714 TGGACGTAAGAGTCACCCAGGGG + Intronic
1106419298 13:29572295-29572317 TTCACACAAGAGTCACTCATTGG + Intronic
1106529820 13:30579625-30579647 TCCTCACTAAAGTCACCCTGAGG + Intronic
1106587378 13:31069034-31069056 TGCACACACAAGTCACCCACAGG - Intergenic
1108122746 13:47207655-47207677 TGCACATTAAAGTTACCCAGGGG - Intergenic
1109910784 13:68907388-68907410 TACACACTAGAGTGGGCCAGGGG - Intergenic
1112223244 13:97513152-97513174 TGCCCACTGGATTCCCCCAGTGG - Intergenic
1112731995 13:102373844-102373866 TGCACACTGGAATCACCTATGGG + Intronic
1113933304 13:113980039-113980061 TGCACACAGGAGGCACACAGAGG - Intronic
1114954068 14:27795920-27795942 TGCACATTAGAGTCACCTTGGGG + Intergenic
1117006868 14:51429359-51429381 TGCACATTAGAATCACCTGGGGG - Intergenic
1119778230 14:77261175-77261197 TGCACACTGGAATCACCTGGGGG - Intergenic
1121317376 14:92970350-92970372 GGCACACGACAGGCACCCAGCGG + Intronic
1121378436 14:93436042-93436064 TGCACACTGGAGACACAGAGAGG - Intronic
1122153401 14:99736695-99736717 TGCACCCCAGAGTGACCCTGTGG + Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1125264110 15:37859937-37859959 TGTACATTAGAATCACCCAGGGG + Intergenic
1125878894 15:43175071-43175093 TGCACATTAGAATAACCTAGGGG - Intronic
1125882358 15:43205754-43205776 TGCACATTAGAATCACCTGGGGG - Intronic
1126197472 15:45948372-45948394 TGTACACTAGAATCACCTGGGGG - Intergenic
1128114411 15:65096341-65096363 TGCACATTAGAATCACCTGGAGG - Intronic
1128730545 15:70017851-70017873 TGCACATTGAAGTCACCTAGGGG + Intergenic
1128772857 15:70295362-70295384 TGCCCATTAGAGCCACCAAGAGG + Intergenic
1130204979 15:81867499-81867521 TGCAAACCAAAGTGACCCAGAGG + Intergenic
1133356903 16:5143390-5143412 TCCACACTGGAGTCACCCAGAGG + Intergenic
1133761516 16:8802397-8802419 TGTACACTAGAATCTCTCAGAGG - Intronic
1134059866 16:11192753-11192775 TGCACACCAGCTTCACCAAGAGG + Intergenic
1134345912 16:13391699-13391721 TGCACAATGGAGTCACCTGGGGG - Intergenic
1134762949 16:16730180-16730202 TGCACAGGAGAGTCACTCGGGGG + Intergenic
1134983103 16:18628969-18628991 TGCACAGGAGAGTCACTCGGGGG - Intergenic
1137725689 16:50655179-50655201 TTAACATTGGAGTCACCCAGAGG + Intergenic
1138860714 16:60752865-60752887 TGAATCCTAGATTCACCCAGGGG + Intergenic
1139253441 16:65518884-65518906 TGCACAGAAGAATCATCCAGAGG - Intergenic
1139553507 16:67690580-67690602 TGCACACTAGGATCACCTGGGGG - Intronic
1141391640 16:83669335-83669357 TGCACATTAGAATCTCCCAGAGG - Intronic
1203143272 16_KI270728v1_random:1782987-1783009 TTTACACTAGACACACCCAGTGG - Intergenic
1143127501 17:4652872-4652894 TTCACACTAGATTCAGCTAGTGG - Intergenic
1143804781 17:9417368-9417390 TGCACCCTGGAATCACCTAGAGG + Intronic
1144506317 17:15834260-15834282 TGCCCACTAGACTCACGGAGGGG - Intergenic
1145170493 17:20652193-20652215 TGCCCACTAGACTCACGGAGGGG - Intergenic
1147721545 17:42542818-42542840 TGAACATGAGAGTTACCCAGAGG - Intronic
1148038000 17:44682962-44682984 TGCACATTAGAATCACCTACAGG + Intronic
1148241239 17:46000631-46000653 TGCACACTAGAGTCACCCAGGGG - Intronic
1150888212 17:69112233-69112255 TGCACACTTCAGTCTCCCATTGG + Exonic
1152256927 17:79245288-79245310 GGCACACTAGAGGGACCTAGAGG + Intronic
1155721860 18:29024262-29024284 TGCACAGAAGAGTCTCCAAGAGG + Intergenic
1156588215 18:38456615-38456637 CCCACACTAGAGTCACACAGAGG - Intergenic
1156772444 18:40745413-40745435 TTCACAATAGAGAAACCCAGGGG + Intergenic
1159021479 18:63146475-63146497 TCCACGCTGGAGTCAGCCAGAGG + Intronic
1159741607 18:72178375-72178397 TGCAGAATAGACTAACCCAGTGG - Intergenic
1161619625 19:5291238-5291260 AGCACCCCAGAGGCACCCAGTGG - Intronic
1166625169 19:44345180-44345202 TGCACACTGTAGTCACCTGGGGG - Intronic
927099688 2:19778494-19778516 AGCACACAAGAGACATCCAGGGG + Intergenic
927441488 2:23121612-23121634 AGAGCACTGGAGTCACCCAGAGG + Intergenic
928963363 2:36952768-36952790 TGAAAAGTAGAGTCAGCCAGGGG - Intronic
930381230 2:50632580-50632602 TGTACACTAGAATCACCTTGGGG - Intronic
931756430 2:65378755-65378777 TGCACACTGGAATCACCTGGAGG + Intronic
934483199 2:94673049-94673071 TGCACATTAGAGTCACCTTGGGG - Intergenic
936503394 2:113084445-113084467 TGCCCTCTAGAGTTACACAGTGG - Intergenic
938961969 2:136352218-136352240 TGCACATTAGAATCACCTGGGGG + Intergenic
939614563 2:144348036-144348058 TGCACATTAGAATCACCTGGGGG + Intergenic
940129965 2:150369974-150369996 TGGACACTAGAGTCCACCATGGG + Intergenic
940893095 2:159054384-159054406 TGCACATTAGAATCACCTGGTGG + Intronic
942719430 2:178934113-178934135 TGCACACTGGAGTCACCTGGGGG - Intronic
944533782 2:200689894-200689916 TGCTCACCAGAGTCATCCTGAGG + Intergenic
947310540 2:228796949-228796971 TGCACATTTGAATCACCAAGGGG - Intergenic
947374401 2:229481237-229481259 TTCACACCAGACTCACCAAGAGG + Intronic
1169096857 20:2908449-2908471 TGCACACTCAAGTCCCACAGTGG - Intronic
1170036052 20:11991306-11991328 TGCACATTAGAATCACCCTGGGG + Intergenic
1170392393 20:15889793-15889815 TGCACAGTTGAGTCCCTCAGGGG + Intronic
1171934026 20:31256749-31256771 TGCACACTGGACTCACCCAAAGG + Intergenic
1175942704 20:62545317-62545339 TGCACACTCGACTCACTGAGTGG + Intergenic
1179106541 21:38405552-38405574 TGCTCATTAGAGTCACCTGGGGG - Intronic
1180708096 22:17821953-17821975 TGCACACAAGAGTGGCTCAGGGG - Intronic
1183926835 22:41212306-41212328 TGCACATTAGAATCATCTAGGGG + Intronic
1184026117 22:41857919-41857941 CCCACACTCTAGTCACCCAGAGG - Intronic
1184214794 22:43059565-43059587 TGCACCCCAGAGGAACCCAGCGG + Intronic
1184870362 22:47233859-47233881 TGGACACTAGAGTCCACCATGGG + Intergenic
950918141 3:16666050-16666072 TCCAAACTAGGGTCTCCCAGAGG - Intronic
951428769 3:22581964-22581986 TGAACATCAGAATCACCCAGAGG + Intergenic
953137146 3:40190796-40190818 TGCACAGTAGAATCACCAGGAGG - Intronic
953186470 3:40642565-40642587 TGCACACCTGAGTCACCAACTGG - Intergenic
953352639 3:42227519-42227541 TGCACACCAGAATCACCTTGAGG - Intergenic
953505075 3:43477893-43477915 TGCACACCAGAGGCACACATAGG + Intronic
954971354 3:54654157-54654179 AGCACATTGGAGTCACCGAGGGG + Intronic
955954838 3:64278124-64278146 TGCACACAAGAGAGAGCCAGTGG - Intronic
956979749 3:74622104-74622126 TGCACATTAGAATCACCTGGAGG + Intergenic
961107209 3:124252175-124252197 TGCACATTAGAATCACCAGGGGG + Intronic
961209260 3:125112878-125112900 TGCACATTAGAATCACCTGGAGG - Intronic
965216138 3:165867365-165867387 AGGACACTAGAGGCACCCTGAGG - Intergenic
969067141 4:4494986-4495008 TGTACATTAGAATCATCCAGGGG - Intronic
971344361 4:25798459-25798481 TGCACACTGGAATCACCTGGGGG - Intronic
971522727 4:27574802-27574824 TGCACACTGGGGCCTCCCAGAGG - Intergenic
972360048 4:38318384-38318406 TGCAGACTAGGGTCACTCAAAGG + Intergenic
972876952 4:43374348-43374370 TGCATCCTAGAGGCACCCTGGGG + Intergenic
978083920 4:104626434-104626456 TACACACTAGAGCCAGCCAGTGG - Intergenic
978701351 4:111650400-111650422 TGCACACTAGAATTCCCCTGGGG + Intergenic
978912255 4:114078014-114078036 TGGACTCTACAGTCACCAAGTGG + Intergenic
981184795 4:141788218-141788240 TGCACACCAGAGCCAGCCTGAGG - Intergenic
984157644 4:176211122-176211144 GACACACTCGAGTCTCCCAGAGG + Intergenic
985842472 5:2318794-2318816 TGCACACCAGGGCCAGCCAGGGG - Intergenic
986340027 5:6780974-6780996 TGCACACTACTGACACCTAGTGG - Intergenic
987337034 5:16906159-16906181 TGCACCCTAAAGTCTGCCAGTGG - Intronic
989156440 5:38348890-38348912 TGCACATTAGAATCACCTGGAGG + Intronic
990031807 5:51270437-51270459 TGCACATCAGAATAACCCAGAGG + Intergenic
991977460 5:72197166-72197188 TTCACACTACGTTCACCCAGGGG - Exonic
993529890 5:89011217-89011239 TGCACGTTAGATTCACCTAGAGG - Intergenic
993710899 5:91223720-91223742 TGCACATTAGAATCATCTAGGGG - Intergenic
994367806 5:98935265-98935287 GGCACATTAGAATCACCTAGGGG - Intergenic
1000142129 5:158415703-158415725 TGCACAATAGAATCACCCGGGGG + Intergenic
1000884850 5:166739524-166739546 TGAAAACTAGACTCACCCTGTGG + Intergenic
1001556644 5:172641495-172641517 AGCTCTCCAGAGTCACCCAGCGG - Intronic
1003055651 6:2817230-2817252 TGCACTCTAAAGTAACCCACAGG - Intergenic
1003422194 6:5968596-5968618 TGCACATTAGAATCACCTGGGGG + Intergenic
1004482201 6:16031628-16031650 TGCACACTAGAGGGACGGAGTGG + Intergenic
1010242100 6:73625749-73625771 TGCATATAAGAATCACCCAGGGG + Intronic
1011755757 6:90496896-90496918 AGCACACTCCAGTCACCCACAGG + Intergenic
1012494932 6:99823308-99823330 AGCAAATTAGACTCACCCAGAGG - Intergenic
1015166076 6:130201562-130201584 TGCACATTAAATTCACCTAGTGG - Intronic
1015314832 6:131806681-131806703 TGCAGAATAGAGTCACACATAGG - Intergenic
1016212871 6:141561878-141561900 TGCTGACTATAGTCACCCTGCGG + Intergenic
1017187890 6:151620955-151620977 AGATCACTAGAGTCACACAGTGG - Exonic
1017820934 6:158048643-158048665 TGCATGCTGGAGTCACCCATGGG - Intronic
1018370748 6:163165627-163165649 AGCGCACTAGGGTAACCCAGGGG + Intronic
1019846688 7:3509879-3509901 TGCACGTTAGAATCACCTAGTGG + Intronic
1021606310 7:22412754-22412776 TGCACCTTAGAATTACCCAGGGG - Intergenic
1021856794 7:24864930-24864952 TGCACATTAGAATCACCCAGAGG - Intronic
1023077492 7:36498572-36498594 TGCACAAGAGAATCACCCAGGGG + Intergenic
1023121948 7:36918478-36918500 TGCATATCACAGTCACCCAGGGG + Intronic
1024938776 7:54740539-54740561 TGCACATTAGAATCACCTGGGGG + Intergenic
1031515002 7:122689890-122689912 TGGACGCTAGAGTCAGCCAGGGG + Intronic
1032689833 7:134273528-134273550 TGCACACTGGACTCACTCTGGGG - Intergenic
1032982164 7:137296767-137296789 TGCACACTAGTGAAACACAGAGG + Intronic
1033229760 7:139587559-139587581 GGCTCAGTAGAGACACCCAGAGG + Intronic
1039258288 8:35742809-35742831 TGCACACAAGTGCCAACCAGAGG - Intronic
1041006848 8:53503876-53503898 TGTACATCAGAATCACCCAGAGG + Intergenic
1042938646 8:74085948-74085970 TGTTAACTAGAGTCACCCTGCGG + Intergenic
1046090676 8:109499852-109499874 TACACTCTAGAGTTTCCCAGTGG - Intronic
1046667996 8:117026144-117026166 AGCACACCAAAGTCAGCCAGGGG - Intronic
1047041746 8:121004832-121004854 TGCAATCTAGAGTCTCCCACAGG - Intergenic
1047690528 8:127348970-127348992 TGGGCACCAGAATCACCCAGAGG - Intergenic
1047976581 8:130136537-130136559 TGCACATTACAATCACCTAGTGG + Intronic
1048375314 8:133817991-133818013 TGCACTCTAGATTTACCCAGAGG + Intergenic
1050072032 9:1825239-1825261 TGCACATTAGAATCACCTGGGGG + Intergenic
1051513999 9:17908273-17908295 TGCACAGTAGAATTACCTAGGGG + Intergenic
1053674582 9:40411331-40411353 TGCACATTAGAGTCACCTTGGGG + Intergenic
1053924374 9:43037695-43037717 TGCACATTAGAGTCACCTTGGGG + Intergenic
1054385688 9:64551395-64551417 TGCACATTAGAGTCACCTTGGGG + Intergenic
1054510038 9:65964960-65964982 TTCACATTAGAGTCACCTTGGGG - Intergenic
1058079509 9:100687344-100687366 TGCACACTAAAGTCACCTGGGGG + Intergenic
1060740614 9:126095518-126095540 TGCACACTGCTGTCATCCAGGGG + Intergenic
1061112272 9:128582656-128582678 TGAACACTAGAGACTCACAGGGG + Intronic
1062605787 9:137348416-137348438 TGAGCACTAGAGCCCCCCAGGGG - Intronic
1186799084 X:13075172-13075194 TGCCCACTGCAGTCACCCATGGG + Intergenic
1187233512 X:17444707-17444729 AGCACACCACAGGCACCCAGAGG + Intronic
1190936777 X:55004906-55004928 TGCACAATAAAGTCACACTGGGG - Intronic
1195134112 X:101886465-101886487 TGCATACTAGTGTCCCTCAGGGG - Intronic
1195366757 X:104134086-104134108 AGCACACCAGAGTCACAGAGGGG + Intronic
1196667004 X:118327321-118327343 TGCACATCAGAATCACCCAGAGG - Intergenic
1197331367 X:125157059-125157081 TGCACATTAGAATCACCTGGGGG + Intergenic
1198580392 X:138058027-138058049 TGCACTCTAGAGTCCACCAGAGG - Intergenic
1199581641 X:149366487-149366509 TGCAGACCAGAGTCACCAATGGG - Intergenic
1201147668 Y:11073696-11073718 GACACACAAGAGTCACCCAGGGG + Intergenic