ID: 1148244313

View in Genome Browser
Species Human (GRCh38)
Location 17:46020587-46020609
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148244309_1148244313 14 Left 1148244309 17:46020550-46020572 CCCGATACTGGGCAGTCTAAAAG 0: 1
1: 0
2: 0
3: 22
4: 409
Right 1148244313 17:46020587-46020609 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
1148244310_1148244313 13 Left 1148244310 17:46020551-46020573 CCGATACTGGGCAGTCTAAAAGA 0: 1
1: 0
2: 1
3: 14
4: 256
Right 1148244313 17:46020587-46020609 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148244313 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intronic
Too many off-targets to display for this crispr