ID: 1148246152

View in Genome Browser
Species Human (GRCh38)
Location 17:46032132-46032154
Sequence AGGGGTGCTGAGTGCAGTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148246150_1148246152 -7 Left 1148246150 17:46032116-46032138 CCGAGCCACAGGGGTGAGGGGTG 0: 1
1: 0
2: 5
3: 30
4: 274
Right 1148246152 17:46032132-46032154 AGGGGTGCTGAGTGCAGTTCCGG 0: 1
1: 0
2: 2
3: 26
4: 189
1148246142_1148246152 21 Left 1148246142 17:46032088-46032110 CCTCACTGGCTAAGTGTCGCGGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1148246152 17:46032132-46032154 AGGGGTGCTGAGTGCAGTTCCGG 0: 1
1: 0
2: 2
3: 26
4: 189
1148246149_1148246152 -6 Left 1148246149 17:46032115-46032137 CCCGAGCCACAGGGGTGAGGGGT 0: 1
1: 0
2: 2
3: 29
4: 344
Right 1148246152 17:46032132-46032154 AGGGGTGCTGAGTGCAGTTCCGG 0: 1
1: 0
2: 2
3: 26
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148246152 Original CRISPR AGGGGTGCTGAGTGCAGTTC CGG Exonic
900195469 1:1373521-1373543 ATGTGTGCTGTGTGCAGTTCAGG - Intergenic
900335381 1:2160589-2160611 AGGGATTCTCAGTGCAGTGCTGG + Intronic
900440961 1:2655035-2655057 GGGGGTGCAGCGTGCTGTTCCGG - Intronic
900441016 1:2655315-2655337 GGGGGTGCAGCGTGCTGTTCCGG - Intronic
900518668 1:3095346-3095368 AGGGGTGCTGGGTGCCGCTGGGG + Intronic
902885799 1:19403859-19403881 AGGGGCACTGGGTGCAGCTCAGG - Intronic
903015912 1:20361775-20361797 GGGGGTGGTTAGTTCAGTTCGGG - Intergenic
903671462 1:25038128-25038150 ACCAGTGCTGAGTGCAGTGCTGG - Intergenic
903909118 1:26709377-26709399 AGGGGTGCTGGGTGCAGGGGAGG - Intronic
904094419 1:27966200-27966222 AGGGGTGCTGAGTGCTGGGTGGG + Intronic
904461002 1:30679767-30679789 AGGGGTGCTGAGGGCAGCTCAGG + Intergenic
905145374 1:35883580-35883602 AAGGAGGCTGTGTGCAGTTCCGG + Intronic
905866840 1:41381386-41381408 AGGGATGGGGGGTGCAGTTCTGG + Intronic
907562893 1:55407100-55407122 AGGGCTTCAGATTGCAGTTCTGG + Intergenic
912505669 1:110154056-110154078 AGGAGGGGTGAGTGCTGTTCTGG + Intronic
915187352 1:154117790-154117812 AGGAGTGGTGACTGCAGGTCAGG - Exonic
915509448 1:156378476-156378498 CGGGGTGCTGACTGCAGTCCTGG + Intronic
916502895 1:165401656-165401678 AGGGGAGCTGAGGGCAGTCCTGG - Intronic
917930462 1:179819052-179819074 AGGGGTGCTGTGTGCTGGGCTGG - Intergenic
918335850 1:183511999-183512021 ATGGGTCCTGAGTTCAGTTTTGG + Intronic
921213765 1:212920689-212920711 AGAGGTGCAGAGTGGAGATCGGG - Intergenic
921822526 1:219634024-219634046 AGGGCTGCCTAGTGCAGTCCAGG + Intergenic
923093223 1:230755087-230755109 ATTGGTGCTGAGTGCAGCTCAGG + Intronic
1063578916 10:7287657-7287679 ATGGGGGCTGAGTGAAGTCCTGG - Intronic
1063913288 10:10854281-10854303 AAGGGTGCTTATTGCAGTTGTGG + Intergenic
1064738423 10:18407574-18407596 AGGGCTGATCAGTTCAGTTCTGG + Intronic
1065325995 10:24551301-24551323 CTGGGTGCTGAGAGCAGGTCTGG + Intergenic
1068441788 10:57065107-57065129 AGGGCTGATCACTGCAGTTCAGG - Intergenic
1069082790 10:64105970-64105992 AAGGGTGCTGAGTGCAGCTAGGG + Intergenic
1069626576 10:69871576-69871598 AGGGCTGCTGAGAAAAGTTCAGG - Intronic
1071328897 10:84541538-84541560 GGGGGTGCTGAGTGGTGTTTGGG - Intergenic
1073864279 10:107784479-107784501 AGGGCTGCAGCATGCAGTTCAGG - Intergenic
1074492191 10:113947943-113947965 GGGGGTGCTGAGTGGCCTTCAGG + Intergenic
1076428760 10:130387120-130387142 AGGGGTGCAGGGTGGAGGTCTGG + Intergenic
1080559923 11:33453533-33453555 TGGAGTGCTGAGTTCATTTCTGG + Intergenic
1081701935 11:45157834-45157856 ATGGGTGCTGGGTACAGTTTGGG + Intronic
1083259256 11:61514375-61514397 TGGGGTACTTAGTGCAGCTCCGG + Intergenic
1083315480 11:61812470-61812492 GGTGCTGCTCAGTGCAGTTCAGG - Exonic
1083778645 11:64906843-64906865 AGGGTTGCTGAGTGCAGCTGGGG - Intronic
1084603525 11:70160149-70160171 AAGGGTGCAGAGGGCAGGTCCGG - Intronic
1087175536 11:95091744-95091766 AAGAGATCTGAGTGCAGTTCTGG + Intronic
1087265194 11:96053010-96053032 TGGAGTGCTGAATGGAGTTCTGG - Intronic
1089750873 11:120650202-120650224 AAGGATGCTGAGTCCAGTTCAGG + Intronic
1090944135 11:131414455-131414477 AGTGCTGCTGTGTGCAGATCAGG + Intronic
1091679347 12:2515661-2515683 GGTGGGGCTGAGTGCAGTGCAGG + Intronic
1092055974 12:5508174-5508196 AGGGATGGTGAGTGCAGGCCGGG - Intronic
1092830479 12:12439761-12439783 AGAGGAGGTGAGTGCAGTTTTGG + Intronic
1100307308 12:93362564-93362586 AGGGATGTTGAGTTCAGTTCAGG - Intergenic
1101945035 12:109130202-109130224 TGGGGCACTGAGTGCAGTGCTGG - Intronic
1105685114 13:22773139-22773161 AGGGGATCTGAGAGAAGTTCTGG - Intergenic
1107814699 13:44233884-44233906 ATGGGTGCAGAGTTCAGATCTGG - Intergenic
1109637556 13:65142692-65142714 GGGGGAGCTGAGTGAAGTTGAGG + Intergenic
1110288661 13:73778960-73778982 AGTGGTGCTGTTTGCAGTTAAGG + Intronic
1113747037 13:112752403-112752425 GGGGGTGGAGAGTGCAGCTCAGG + Intronic
1115713350 14:36074643-36074665 GGGGGTGCAGAGTGGAATTCAGG - Intergenic
1116221728 14:42096234-42096256 TGGGGTGCTGAGAGCAGCTCAGG - Intergenic
1118880162 14:69818970-69818992 GGGGGTGCGGAGTGCAGATGCGG + Intergenic
1119383744 14:74244461-74244483 AGGGGTGCTGGGGGGAGTTGAGG + Intronic
1120979006 14:90274499-90274521 AGGGGTGCTCACTGCAGTTGGGG - Exonic
1121710757 14:96038020-96038042 GGGTGTGGTGAGTGCAGTACTGG + Intergenic
1122305280 14:100761919-100761941 GGGGGTATTGAGTGCAGTTTTGG - Intergenic
1124361013 15:29036468-29036490 AGGGGTGGTGGGAGCAGCTCTGG + Intronic
1125933826 15:43617997-43618019 AGGGGTGCTGGGTGGACTTGTGG - Exonic
1125946923 15:43717459-43717481 AGGGGTGCTGGGTGGACTTGTGG - Intergenic
1129075778 15:72994857-72994879 AGGGGTGGGGTGGGCAGTTCTGG - Intergenic
1132336517 15:101051633-101051655 TGGGGTGCAGAGTGCTGCTCGGG + Intronic
1132708886 16:1257903-1257925 AGGGGCGGTGAATGCAGTCCAGG - Intronic
1132751280 16:1459001-1459023 AGGGTGGCTGAGGCCAGTTCTGG + Intronic
1133234682 16:4382331-4382353 AGGGGAGCTCCGTGCAGCTCAGG + Exonic
1133235173 16:4384332-4384354 AGTGATGCTGAGTGCAGCTGTGG + Intronic
1133984832 16:10660487-10660509 AGGGGTTCTGAGTGGGGGTCTGG - Intronic
1134605722 16:15569667-15569689 AGGGGTGCTAAGTCCACTTCTGG + Intronic
1135615211 16:23905400-23905422 GGGGGTGAGGAGTGAAGTTCTGG - Intronic
1135851144 16:25965077-25965099 AAGGGTGATGAGTTCAGTTCTGG + Intronic
1136234384 16:28905060-28905082 AGGGGAGCAGAGTGCACTTGTGG + Intronic
1138449290 16:57083617-57083639 AGGTGTGCTGAGTGGAGCACTGG + Intergenic
1139061829 16:63262876-63262898 AGGGCTGCTGTGTGCAGCCCAGG - Intergenic
1145009563 17:19360106-19360128 AGGGCTTCTGAGTGCAGTCTTGG + Intronic
1145168193 17:20632863-20632885 AGGGGCGCTGAGTGGGGGTCTGG + Intergenic
1147182812 17:38697423-38697445 AGGGCTGATGAGTTCAGTTTGGG - Intergenic
1148075782 17:44934551-44934573 TGGGGTGCTGCGTGCGGTTACGG + Exonic
1148246152 17:46032132-46032154 AGGGGTGCTGAGTGCAGTTCCGG + Exonic
1149559316 17:57596811-57596833 AGGCGGGGTGAGTTCAGTTCTGG - Intronic
1150123729 17:62623235-62623257 AGTGGAGGTGAGTGGAGTTCCGG - Intergenic
1150210252 17:63437848-63437870 GGGGGTGCTGTGTGCATCTCGGG - Intronic
1153345067 18:4016777-4016799 AGGGCTCCTGAGCTCAGTTCAGG + Intronic
1153776542 18:8459116-8459138 AGTGGTGCTGACTGTCGTTCAGG + Intergenic
1153818153 18:8808805-8808827 AGGGGTTCTCAGTGCAGTGGGGG + Intronic
1157344423 18:46811755-46811777 ATGAGTGCTGTGTGAAGTTCTGG - Exonic
1159088200 18:63818340-63818362 AGGGCTGCAGTGTGCAGCTCAGG - Intergenic
1159574399 18:70157344-70157366 AGGGGTGCTGAGCTGAGCTCTGG + Intronic
1160558133 18:79739371-79739393 AGGGGTGCTAACTCCAGTCCTGG - Intronic
1167659865 19:50790334-50790356 GGGGGTGCTGAGTGCAGGGCTGG + Intergenic
1168229249 19:55018486-55018508 ATGGGTGCAGAGTGGAGCTCTGG - Intronic
925373138 2:3362075-3362097 AGGGGCGCTTAGTGCGGGTCTGG - Intronic
925777044 2:7346053-7346075 AGGGGTGAAGAGTCCAGATCTGG - Intergenic
927486071 2:23489228-23489250 CGGGGTGCTGAGTGATGTGCTGG + Intronic
927826315 2:26312300-26312322 AGAGGGGCTGGGTGCAGGTCAGG - Intronic
929996479 2:46829267-46829289 AGGGGTGCAGAGTGCAGGGCAGG - Intronic
932469005 2:71941845-71941867 GGAGGCGCTGAGTGCAGTTGGGG - Intergenic
932671831 2:73743895-73743917 TGGGGTGCAGGGTGCAATTCTGG - Intergenic
932803534 2:74764074-74764096 AGGGGAGAGGAGTGCAGTTCTGG + Intergenic
932803567 2:74764235-74764257 TGGGGAGAGGAGTGCAGTTCTGG + Intergenic
933223464 2:79717632-79717654 AGTGGTGGTCAGTTCAGTTCTGG - Intronic
933714577 2:85350683-85350705 GGGGGTGGAGAGTGCAGTGCGGG - Intronic
936087962 2:109482337-109482359 AGTGGGGCTAAGAGCAGTTCAGG + Intronic
938207713 2:129438317-129438339 AGGGATGCTGAGGCCAGGTCTGG - Intergenic
940108681 2:150126782-150126804 AGGGCAGCACAGTGCAGTTCTGG - Intergenic
942310761 2:174654769-174654791 TGGGTTGCAGAGAGCAGTTCAGG - Intronic
943989852 2:194674279-194674301 TGGAGTACTGAGTTCAGTTCTGG + Intergenic
944376801 2:199054766-199054788 AGGGATGCTGAGAGCAGCACAGG + Intergenic
944831080 2:203534867-203534889 AGGGGCGCAGGGTGCAGTCCAGG + Intronic
945675639 2:212852374-212852396 AGGCCTGCTGAGTGCAATTAAGG - Intergenic
948101152 2:235374126-235374148 AGGGGTGGTGAGTGCTATGCGGG - Intergenic
1171051782 20:21866095-21866117 AGTGGGGCTGAGTGCAGGGCAGG - Intergenic
1172799073 20:37563939-37563961 TGGGGTGCTGAGTCCGCTTCTGG - Intergenic
1175719326 20:61275733-61275755 TGGAGTACTGTGTGCAGTTCGGG + Intronic
1175974665 20:62704541-62704563 AGGGATGCCGAGGGCAGGTCGGG - Intergenic
1178487936 21:33030604-33030626 AGGGGTCTTGATTGCAGTTTTGG + Intergenic
1179610056 21:42544590-42544612 AGGGGAGCGGAGTGCAGCCCGGG - Intronic
1179908594 21:44436511-44436533 TGGGGTGCAGAGTGCAGCCCGGG - Intronic
1179908620 21:44436593-44436615 TGGGGTGCTGAGTGCAGCCCAGG - Intronic
1181056449 22:20262602-20262624 GTGGGGGCTGAGTGCAGGTCTGG - Intronic
1184220532 22:43097019-43097041 AGGGGATCTGAGTCCAGGTCTGG + Intergenic
1185215603 22:49598432-49598454 AGGGTTGCTCAGTGCAGTGTGGG + Intronic
1185396935 22:50597275-50597297 AGGGCTGCTCTGTGCAGCTCAGG - Intronic
949746987 3:7306673-7306695 AGGTTTGCTGAGAGAAGTTCTGG + Intronic
950289335 3:11770976-11770998 AGGGCTGCGGAGAGCAGGTCTGG - Intergenic
950497970 3:13345566-13345588 ACGGGTGGTGTGTGCAGCTCGGG - Intronic
951522037 3:23619370-23619392 CGGGATGCTGAGTGGAGTTGGGG - Intergenic
952203674 3:31157481-31157503 AGGGGTGCAGTGTTAAGTTCAGG - Intergenic
953069563 3:39505859-39505881 AGAGCTGCTGAGTGCAGTTTGGG + Intronic
955001495 3:54931528-54931550 AGAGATGCTGAATGCAGCTCAGG + Intronic
959747413 3:109792884-109792906 AGGGGTGTTCAGAGCAGATCAGG - Intergenic
962017215 3:131454133-131454155 GGGGGGGCTGAGTGCTGTTGAGG - Intergenic
962838868 3:139215446-139215468 AGTGCTTCTGAGGGCAGTTCAGG + Intronic
963340721 3:144029293-144029315 AGTGGTGCTGGGTCCAGTTTTGG + Intronic
964739606 3:159951574-159951596 AGGGGTGCTAAGTTGGGTTCTGG + Intergenic
965070561 3:163911317-163911339 AAGGCTGCAGAGTGCAGTCCTGG - Intergenic
967123711 3:186406352-186406374 AGGAGAGCTGAGTTCAGGTCAGG - Intergenic
967380329 3:188850778-188850800 TGGAGTGCTGAGTTCAGTTCTGG + Intronic
967431298 3:189388811-189388833 ATGAGTTCTGAGTGCAATTCTGG + Intergenic
967614391 3:191547455-191547477 AGGGGGCCAAAGTGCAGTTCAGG - Intergenic
969279600 4:6161126-6161148 AGGGGAGGTGAGTGGAGATCAGG - Intronic
969279605 4:6161146-6161168 AGGGGAGGTGAGTGGAGATCAGG - Intronic
969279610 4:6161166-6161188 AGGGGAGGTGAGTGGAGATCAGG - Intronic
969279622 4:6161224-6161246 AGGGGAGGTGAGTGGAGGTCAGG - Intronic
969604442 4:8195492-8195514 CGGGGTGCTCTGTGCAGTTGGGG + Intronic
969992115 4:11275369-11275391 AGGGGTGAAGACTGGAGTTCAGG + Intergenic
973100006 4:46254820-46254842 ATGGAAGCTGAGTGCACTTCTGG - Intronic
973795046 4:54416616-54416638 AGAAGTCCTGAGTCCAGTTCTGG - Intergenic
974500429 4:62693318-62693340 AGATCTGCTGAGTGAAGTTCTGG - Intergenic
976416094 4:84777165-84777187 AGGGATGCTAAGTTCAGTTAAGG + Intronic
984094815 4:175421726-175421748 AGGAGAGCTGAGTGCAGTGCAGG - Intergenic
984704407 4:182837204-182837226 AGGGGTGCTCTGAGCAGCTCAGG - Intergenic
985721712 5:1493008-1493030 AAGGGTGCTGAGTGGAGCTGGGG + Intronic
990043316 5:51398395-51398417 AGGAGTCCTAAGTGCAGTTCCGG - Intergenic
996150616 5:120030038-120030060 AGGCTTGCTGAGCACAGTTCTGG - Intergenic
996311955 5:122116456-122116478 AAGGGGGGTGAGTGCATTTCAGG + Intergenic
996627881 5:125591288-125591310 AGGGGTCATCAGTGCAGTTTAGG + Intergenic
996747628 5:126858661-126858683 AGGCGAGCTGACTGCAATTCAGG + Intergenic
999840991 5:155426235-155426257 AGGGGTGCAGAGTCCAGATTGGG + Intergenic
1001194270 5:169657227-169657249 AGGGGGTCTGAGAGCAGGTCTGG + Intronic
1001589365 5:172855048-172855070 AGGAGAGCTGAGTCCATTTCAGG - Intronic
1003411454 6:5866542-5866564 AGGTGTGGTCAGTGCAGTGCTGG + Intergenic
1004579394 6:16934044-16934066 AGGGGTGCAGAATTCTGTTCAGG + Intergenic
1004651585 6:17614639-17614661 GGGGGGGGGGAGTGCAGTTCTGG + Intergenic
1006036445 6:31216693-31216715 AAGGGTGCTGCTTGCACTTCTGG - Intergenic
1006393128 6:33770626-33770648 AGGGCTGCTGAGTGTGCTTCTGG - Intergenic
1010337154 6:74700050-74700072 AGGAGTGCTTAGTGCAGCCCTGG - Intergenic
1013546359 6:111161538-111161560 AGGGGTGCGGGGTGCTGTTTTGG + Intronic
1015035568 6:128650117-128650139 AGGGCTGCAGAGTGAAGATCAGG + Intergenic
1016898281 6:149075317-149075339 AGGGGTCCTGAGTTCTGTGCAGG + Exonic
1019064968 6:169288866-169288888 AGGGGCGCTGTGTGGAATTCTGG - Intergenic
1020040276 7:4996305-4996327 AGGGGTGCTGAGTGCTGGGTGGG + Intronic
1020478260 7:8624850-8624872 AGGGCTCCTCAGTGCAGTTTGGG + Intronic
1022886204 7:34647505-34647527 ATGTGTGCTCAGTGCAGTTGTGG - Intergenic
1023190093 7:37570932-37570954 AGGGGTACTGGAAGCAGTTCTGG + Intergenic
1023852247 7:44157020-44157042 AGGGGTGCCCAGAGCAGGTCTGG - Intronic
1024191384 7:47014719-47014741 ACGGGTCCTGAGAGAAGTTCTGG - Intergenic
1029482559 7:100822200-100822222 GTGGGTCCTGAGTGGAGTTCAGG + Intronic
1029517659 7:101036524-101036546 AAGGGTGCTGATTGCAGAGCTGG - Exonic
1029517819 7:101037937-101037959 AAGGGTGCTGATTGCAGAACTGG - Exonic
1029518129 7:101040769-101040791 AAGGGTGCTGATTGCAGAACTGG - Exonic
1029544550 7:101203357-101203379 TGGGGTGCTGGGTGCGGTTGGGG - Intergenic
1029604605 7:101590921-101590943 AGGGGTGCTGAGGGCACTCTTGG + Intergenic
1031077040 7:117222971-117222993 AGGGGTGATGAGTTCAGTTTTGG - Exonic
1032090943 7:128911345-128911367 AGGGGTGTTGAGTGGAGTTCAGG - Intergenic
1034275353 7:149821543-149821565 AGCGGTGGTGAGTGCAGGGCAGG + Intergenic
1034447242 7:151119952-151119974 AGGGCTGCTGAGGGCAGCTCCGG - Intronic
1034629291 7:152518119-152518141 AGGGGTGCTGAGGTCCCTTCAGG - Intergenic
1035206904 7:157299913-157299935 AGGGGTGCTGGGTGCAGGGCGGG - Intergenic
1036690495 8:10941717-10941739 ATGGGTGCTGAGTGCTGTGGAGG + Intronic
1036915490 8:12799883-12799905 AGGGGGGCTGAGGGCAGCTTGGG - Intergenic
1038072781 8:24035970-24035992 AGAGGTGCTGAGTTCAGTTTTGG + Intergenic
1040014820 8:42691656-42691678 AGGGGCGCGGAGTGCAGCACGGG - Intergenic
1040658546 8:49542562-49542584 ATGGGTGCTGAATGCATTTTAGG - Intronic
1041813914 8:61944718-61944740 AGGGGTGCTGAGTTGTGTTTTGG - Intergenic
1042406446 8:68410815-68410837 AGGGGTGCTGTTGGCAGTTGCGG - Intronic
1047721763 8:127646793-127646815 AAGTGTTCTGAGTGCATTTCAGG - Intergenic
1048416319 8:134231357-134231379 AGGGGTGCTCAGTGTTATTCTGG - Intergenic
1049822752 8:144646071-144646093 AGGGGTGACCAGTGCAGCTCCGG - Intergenic
1049836511 8:144738954-144738976 AGGGCTGCTGTGTGCATCTCTGG - Intronic
1050965339 9:11794938-11794960 AGGAGTGCTGAGTTCAGCTTTGG - Intergenic
1051384750 9:16495583-16495605 AGTGGTGCTGAATGTAGTTCAGG + Intronic
1052609916 9:30758966-30758988 AGGGGTGCCAAGGGCAGCTCGGG - Intergenic
1052864039 9:33454188-33454210 AAGGCTGCTGAGGGCAGGTCAGG - Intergenic
1057250096 9:93494099-93494121 ACGGGTTCTTAGTGCAGTTCAGG + Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1061010312 9:127950753-127950775 AAGGGTGCTTTGTGCAGCTCAGG - Intronic
1062613679 9:137386745-137386767 AGGGGTGCTGAGGGGGCTTCCGG - Intronic
1193425404 X:81336623-81336645 AGGGCTGCAGTGTGCAGCTCTGG - Intergenic
1194100157 X:89693944-89693966 GGGGGTGCAGCATGCAGTTCAGG - Intergenic
1195771681 X:108358095-108358117 AGGGGTGCTGTGTGCATCTGGGG - Intronic
1198065386 X:133091367-133091389 AGGAGTGCGGAGTGCTGCTCAGG - Exonic
1199772278 X:150982912-150982934 AGGGGAGCTGACTGCAGGCCAGG + Intronic
1200689447 Y:6292297-6292319 TGCGGAGCTGAGTTCAGTTCCGG + Intergenic
1201045826 Y:9882423-9882445 TGCGGAGCTGAGTTCAGTTCCGG - Intergenic