ID: 1148246232

View in Genome Browser
Species Human (GRCh38)
Location 17:46032532-46032554
Sequence AAGTGCCTAGTGAATTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148246227_1148246232 22 Left 1148246227 17:46032487-46032509 CCAAGAAAAAAGCATGGCTGAAC 0: 1
1: 0
2: 0
3: 16
4: 215
Right 1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1148246225_1148246232 27 Left 1148246225 17:46032482-46032504 CCATCCCAAGAAAAAAGCATGGC 0: 1
1: 1
2: 3
3: 20
4: 311
Right 1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1148246226_1148246232 23 Left 1148246226 17:46032486-46032508 CCCAAGAAAAAAGCATGGCTGAA 0: 1
1: 0
2: 3
3: 33
4: 342
Right 1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1148246229_1148246232 -5 Left 1148246229 17:46032514-46032536 CCAGGTGAGTCCATAGCAAAGTG 0: 1
1: 0
2: 0
3: 16
4: 124
Right 1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148246232 Original CRISPR AAGTGCCTAGTGAATTCAGG AGG Intronic
902361698 1:15945589-15945611 AAGTGCATGGTGACTCCAGGTGG + Intronic
903315601 1:22502468-22502490 AAGTGCTATATGAATTCAGGAGG - Intronic
907304744 1:53507210-53507232 AAGTGCCCAGTAAATGCTGGTGG - Intronic
908807528 1:67946595-67946617 GAGTGTCTAGTTAATTCAAGTGG + Intergenic
909005851 1:70275602-70275624 TGGTGCCTAGTGCATGCAGGAGG + Intronic
913122027 1:115751334-115751356 AAGGGCCTTGTGATTTAAGGAGG + Intronic
913178125 1:116293578-116293600 AAGTGCCCAGTGAATTCCAGAGG + Intergenic
921151523 1:212406851-212406873 AAGTGCCCAGGTAAATCAGGAGG - Intronic
923365540 1:233257246-233257268 AAGTATCTAGTAAGTTCAGGAGG - Intronic
1064316710 10:14264210-14264232 ATGTGCCCAGGGATTTCAGGCGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1070729899 10:78819483-78819505 AAGGGCCCAGTGACTTCAAGTGG - Intergenic
1071824172 10:89307947-89307969 AAGTGCCTGATTAATTGAGGTGG + Exonic
1073874496 10:107906503-107906525 AAGTGCCAAGAGAATTAAAGAGG + Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1080099753 11:28446132-28446154 AAGCAGCTAGTGAATGCAGGGGG + Intergenic
1081007843 11:37770160-37770182 AAGTGCATAGTAAAGTCAGAAGG + Intergenic
1083882237 11:65554296-65554318 AAGCGCCCAGTGAAGTCCGGGGG + Exonic
1083989011 11:66235254-66235276 AACTGCCTACTGACTTCAGCTGG - Intronic
1084227710 11:67727647-67727669 AAGGGCCTATTGAACTCCGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1086310101 11:85526059-85526081 CAATGCCTAGTGAATTAAGAAGG - Intronic
1092105970 12:5922018-5922040 TAGTGCCTGGTGAATTCCCGTGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1095147390 12:38747655-38747677 AAGTACTCAGTGAATGCAGGTGG - Intronic
1095520578 12:43059996-43060018 AATTGACTAGTGAATTCATTTGG - Intergenic
1096435489 12:51587235-51587257 AATTGCCTAGTGAAATCATCTGG - Intergenic
1096762892 12:53857943-53857965 AAGTGCCAAGACAATTCAGTGGG + Intergenic
1100339899 12:93668888-93668910 AAGTGCCTATTGAACTCCAGTGG + Intergenic
1100628031 12:96356667-96356689 AAGTTCTTACTGAACTCAGGAGG - Intronic
1103138456 12:118527884-118527906 ATGTAGGTAGTGAATTCAGGAGG + Intergenic
1104217925 12:126752780-126752802 AAGTGCCTAGATAAGTCATGTGG + Intergenic
1104743307 12:131194416-131194438 AAAGGCCTGGTGGATTCAGGGGG + Intergenic
1106811906 13:33366643-33366665 AAGAGCTTAGTGAACTAAGGGGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1109720276 13:66267321-66267343 AAGATGCTAGAGAATTCAGGTGG + Intergenic
1110860004 13:80337814-80337836 AAGTGAGGAGTCAATTCAGGTGG - Intronic
1111647554 13:91049693-91049715 AAGTGCTTAGAGAATGAAGGAGG - Intergenic
1112872486 13:103992126-103992148 ATGTGCCAAGTGCATTCAGATGG - Intergenic
1115253892 14:31378042-31378064 AAGTTCCTGGTGAATTAAGGAGG - Intronic
1115444956 14:33479394-33479416 AGGTCCCTAGTGAAGACAGGAGG + Intronic
1116637523 14:47416558-47416580 CAGTGCCTAGTGGAGTCATGGGG - Intronic
1118791779 14:69100045-69100067 AAGTGACCAGTGAATTCAGCAGG + Intronic
1119267474 14:73271833-73271855 ACGTTCCTAGTAAATTCAGAGGG + Intronic
1121899711 14:97682896-97682918 AAGTGTTTAGTAAATTCATGTGG - Intergenic
1125291669 15:38155603-38155625 CAGTGCCTAGTGTGTTGAGGTGG - Intergenic
1128213590 15:65918671-65918693 GAGGGCCTTGTGAACTCAGGAGG - Intronic
1129512569 15:76135796-76135818 AATTACTTGGTGAATTCAGGTGG + Intronic
1129516155 15:76158987-76159009 AAGTGCCCAGTGCCTTCAGCAGG - Intronic
1134926743 16:18170292-18170314 ATGATCATAGTGAATTCAGGTGG - Intergenic
1136711341 16:32239870-32239892 AAGGGCCTGGTGCATTTAGGTGG + Intergenic
1136756566 16:32689535-32689557 AAGGGCCTGGTGCATTTAGGTGG - Intergenic
1136811544 16:33180838-33180860 AAGGGCCTGGTGCATTTAGGTGG + Intergenic
1136818020 16:33290918-33290940 AAGGGCCTGGTGCATTTAGGTGG + Intronic
1136824584 16:33347447-33347469 AAGGGCCTGGTGCATTTAGGTGG + Intergenic
1136829650 16:33446218-33446240 AAGGGCCTGGTGCATTTAGGTGG + Intergenic
1140930835 16:79626364-79626386 AGGTGCCTTGTGAGTTAAGGAGG - Intergenic
1202990122 16_KI270728v1_random:3807-3829 AAGGGCCTGGTGCATTTAGGTGG + Intergenic
1203058715 16_KI270728v1_random:949889-949911 AAGGGCCTGGTGCATTTAGGTGG - Intergenic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG + Intronic
1150178543 17:63089418-63089440 AAGTGCTGTGTGAATTGAGGGGG + Intronic
1150921092 17:69483821-69483843 GAGTGCCAAGACAATTCAGGGGG + Intronic
1156762883 18:40614602-40614624 AAAGGCCTAGTGAATTCCAGAGG + Intergenic
1157142096 18:45119961-45119983 AAGTGCCATCTGAATTCATGAGG + Intergenic
1157709814 18:49842689-49842711 AAGAGCCTTGTGCCTTCAGGTGG + Intronic
1158777435 18:60601722-60601744 AAGTGCTTAGAGATTTCATGAGG - Intergenic
1162349666 19:10140970-10140992 AAGCGCCTTGTTAACTCAGGCGG + Intronic
1162365407 19:10245737-10245759 ACGTGCCCAGTGACCTCAGGTGG + Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1165681004 19:37775452-37775474 ATGTGCCTTGGGAATTCATGTGG - Intronic
1165755735 19:38291750-38291772 AAGGGCCTGGGGAATCCAGGTGG - Intronic
1166109897 19:40615331-40615353 AGGTGCTTAGTGAATTCTTGTGG - Intronic
927523118 2:23713306-23713328 AAGTGACTGGAGAATTTAGGGGG - Intergenic
927609024 2:24517908-24517930 AAGAGCATAGTGAAATCATGAGG - Intronic
930327121 2:49933925-49933947 AGAGGCCTTGTGAATTCAGGTGG + Intronic
931356286 2:61539533-61539555 AAGGGCCTAGTAAATTTTGGTGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
934876076 2:97922112-97922134 TAGTGCCTGATGATTTCAGGTGG - Intronic
938418876 2:131127434-131127456 AAGGTCATAGTGAATTAAGGTGG - Intronic
938760227 2:134418632-134418654 AATAGCTAAGTGAATTCAGGAGG + Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1170115054 20:12848931-12848953 CAGTGCCTAGTTTATTAAGGGGG - Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1173087078 20:39932515-39932537 AAATGCCTAGTGAAGTCATCTGG - Intergenic
1174727856 20:52882249-52882271 AAGTGCCAAGATAATTCAGTGGG - Intergenic
1175479166 20:59299742-59299764 AAGTGCCCTGAGAAGTCAGGAGG + Intergenic
1177211432 21:18076794-18076816 CAATGCCTAGTGGATTCATGGGG + Intronic
1178577684 21:33809167-33809189 AAGTGGCTAGTGTGTTCATGTGG + Intronic
1180191172 21:46163611-46163633 GAGTGCCAAGACAATTCAGGAGG - Intronic
1181624916 22:24116733-24116755 GATGGCCTAGTGAACTCAGGGGG - Intronic
1181767268 22:25100825-25100847 AAGTGCCTGTTGAAGTCAGAAGG + Intronic
950371404 3:12533941-12533963 AGCAGCCTTGTGAATTCAGGAGG + Intronic
952969054 3:38639286-38639308 AAGTGCCAAATGAATTTAGTTGG + Intronic
953489487 3:43336663-43336685 AACTTCCTAGCTAATTCAGGGGG - Intronic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
960598727 3:119433650-119433672 AATGGCCTAGAGAATTCAGCTGG + Intronic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
961936463 3:130590204-130590226 AAGTGTCCAGTGAACTCAAGGGG - Intronic
962301352 3:134245855-134245877 TAGTGACTTGTGAGTTCAGGTGG - Intronic
968857696 4:3139782-3139804 AAGTGCCTAAGGAATGCAGCTGG + Intronic
969057798 4:4413150-4413172 AAGAGCCTCGTGAAGGCAGGGGG - Intronic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
977463990 4:97359775-97359797 TAGTGCCTAGCTAATACAGGTGG + Intronic
982159929 4:152558333-152558355 AATTGCCCAGTGAATTAAAGAGG + Intergenic
991124335 5:63052587-63052609 AAAAGCCTAGTGAATTGTGGGGG + Intergenic
991996557 5:72393009-72393031 AAATGCCTAGCAAATTAAGGTGG + Intergenic
993775309 5:91987219-91987241 AAGGGCCAAGGGATTTCAGGAGG + Intergenic
994980452 5:106868430-106868452 AAGGGCCTAGTGAATAGTGGAGG + Intergenic
1007239460 6:40414550-40414572 AAGTGCTAAGTAAATGCAGGCGG - Intronic
1009344577 6:62597352-62597374 AAGTGCCTAGTAAATTCTATGGG - Intergenic
1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG + Intronic
1018467036 6:164057559-164057581 AGGTGCCTGGTAAATTCAGGGGG - Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1022145689 7:27537948-27537970 TAGTGTGTAGTGAATTCAAGTGG - Intronic
1022336951 7:29431203-29431225 AAGTGGCTAGAAAAGTCAGGGGG - Intronic
1026874736 7:73872584-73872606 ATGTCCCTAGTGAAGTCAGAGGG - Intergenic
1027184624 7:75963543-75963565 CAGGGCCCAGTGAAGTCAGGAGG - Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030303337 7:107995927-107995949 AATTGCCAAGTCAATTGAGGGGG + Intronic
1032348152 7:131135978-131136000 AAGTGACAAGGGAATTCAGGTGG + Intronic
1034027355 7:147720680-147720702 AAGTGCCTAGTGAAGTGGGGAGG - Intronic
1036006585 8:4671555-4671577 AAGTGTCTGGTGAATTCACGTGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1038808551 8:30816458-30816480 AAGAGCCTAGTCAATTAAGTAGG - Intergenic
1043283225 8:78495688-78495710 AAGTGATTAGTGAAGTCAGAGGG + Intergenic
1044426057 8:92051767-92051789 AAGTTCATAATGTATTCAGGGGG - Intronic
1046823377 8:118659989-118660011 AAGTTCAGAGTGAAGTCAGGTGG + Intergenic
1048257486 8:132916097-132916119 AAGTGCTCTGTGAAGTCAGGTGG + Intronic
1050748786 9:8911319-8911341 AAGTGCCAAGGCAATTCAGTTGG + Intronic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1190640505 X:52479435-52479457 AAGTGCCAAGAGAATTCAGTGGG - Intergenic
1190647167 X:52533430-52533452 AAGTGCCAAGAGAATTCAGTGGG + Intergenic
1190649299 X:52553610-52553632 AAGTGCCAAGATAATTCAGTGGG + Intergenic
1195165840 X:102219502-102219524 AAGTGGCTAGGGATCTCAGGGGG + Intronic
1195193018 X:102467589-102467611 AAGTGGCTAGGGATCTCAGGGGG - Intronic
1195453230 X:105038903-105038925 AAGTAAAAAGTGAATTCAGGAGG - Intronic
1197119643 X:122875258-122875280 AGCTTCCTTGTGAATTCAGGTGG - Intergenic
1197136028 X:123060684-123060706 AAGGGCAGAGTGAATTCATGGGG - Intergenic