ID: 1148264569

View in Genome Browser
Species Human (GRCh38)
Location 17:46215275-46215297
Sequence CAGGGTTCACAGAAGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148264561_1148264569 29 Left 1148264561 17:46215223-46215245 CCATCTTAAGCAGAGGTAACTGC 0: 1
1: 0
2: 1
3: 15
4: 113
Right 1148264569 17:46215275-46215297 CAGGGTTCACAGAAGGAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 283
1148264564_1148264569 -5 Left 1148264564 17:46215257-46215279 CCCAGAGGCAAAGAACAACAGGG 0: 1
1: 0
2: 0
3: 28
4: 247
Right 1148264569 17:46215275-46215297 CAGGGTTCACAGAAGGAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 283
1148264566_1148264569 -6 Left 1148264566 17:46215258-46215280 CCAGAGGCAAAGAACAACAGGGT 0: 1
1: 0
2: 0
3: 12
4: 217
Right 1148264569 17:46215275-46215297 CAGGGTTCACAGAAGGAACTGGG 0: 1
1: 0
2: 2
3: 21
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148264569 Original CRISPR CAGGGTTCACAGAAGGAACT GGG Intronic
902345914 1:15817329-15817351 CTGGGTTAATAGCAGGAACTAGG + Intergenic
902602829 1:17551679-17551701 CAGGGTTCAGAGAATGACCTAGG - Intronic
902961083 1:19963188-19963210 CAGTTTTCACATAAGAAACTGGG - Intergenic
905256838 1:36690199-36690221 CTAGATTCACAGAAGGAAATAGG + Intergenic
905621508 1:39452153-39452175 TAGGTTTTCCAGAAGGAACTGGG + Exonic
907147751 1:52251699-52251721 CTGGCTTCACAGAAGGAGTTAGG + Intronic
907271928 1:53296367-53296389 CTGGGTGCACAGAAGGGACTTGG + Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907847988 1:58227199-58227221 AAAGGTTCAAAGAAGGAAATGGG + Intronic
908108576 1:60872666-60872688 CAAGGATCACAAAAGGAACTTGG - Intronic
911922311 1:103780850-103780872 AAGGGCTCACAGAAGACACTGGG + Intergenic
912514082 1:110207262-110207284 CAGGTTTCAAAGAAGGAAGATGG + Intergenic
913462965 1:119108189-119108211 CTGGGTTCACAGAATGAGTTTGG + Intronic
915057894 1:153152656-153152678 CAGGGATGCCAGAAGGAACAGGG + Intergenic
916638526 1:166700563-166700585 AAGATTTCACAGAAGAAACTTGG - Intergenic
917983676 1:180293226-180293248 CTGGTTTCACAGAATGAGCTGGG + Intronic
918060131 1:181053791-181053813 CTGGGATCACAGAAGGACCTGGG + Intronic
918873772 1:190011524-190011546 CTGGCTTCACAGAATGAATTAGG - Intergenic
920634279 1:207684032-207684054 CAGATTGCACAGAAGGAATTCGG - Intronic
921555805 1:216597366-216597388 GAGAGGTCAAAGAAGGAACTTGG + Intronic
921815867 1:219562715-219562737 CATGCATCATAGAAGGAACTGGG + Intergenic
922565323 1:226597819-226597841 CAGAGATCACAGGAGGAAGTGGG + Intronic
923235189 1:232026056-232026078 GAGGGGTCACAGGAGCAACTGGG - Intronic
923388523 1:233490254-233490276 CAGAGTTCACAGAAGAAACCTGG - Intergenic
1064568112 10:16664006-16664028 CAGGAGTCACAGAAGGGACTAGG + Intronic
1065314897 10:24454020-24454042 GAGGGTTCAAGGAAGGAACAGGG + Intronic
1065355563 10:24837407-24837429 CTGGCTTCACAGAATGAATTAGG - Intergenic
1065811906 10:29450400-29450422 GAGGGTGCACAGAAGGAAAGTGG - Intergenic
1066483853 10:35824792-35824814 CAAAGTTTCCAGAAGGAACTGGG + Intergenic
1067381628 10:45779109-45779131 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1067889327 10:50119743-50119765 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1068138352 10:52973444-52973466 CATGCTTCACAGAAGGAAGGGGG - Intergenic
1068272689 10:54749493-54749515 TGGGTTTCACAAAAGGAACTGGG - Intronic
1068481062 10:57588913-57588935 CTGGCTTCACAGAATGAATTAGG - Intergenic
1072518181 10:96207428-96207450 CAGGCTTCACAGTAGGGACTAGG + Intronic
1074247120 10:111706015-111706037 CAGTGGTCACAGTAGGCACTAGG - Intergenic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1074985520 10:118655569-118655591 CTGGCTTCACAGAATGAATTAGG + Intergenic
1076183049 10:128425506-128425528 AGGTGATCACAGAAGGAACTGGG - Intergenic
1077483929 11:2830313-2830335 AAGGGTTGACAGAGGGATCTGGG + Intronic
1078147187 11:8730131-8730153 CAGGGTTCACAGCGGGATCGAGG + Exonic
1078430736 11:11286403-11286425 AAGTGTTCACTGTAGGAACTGGG + Intronic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1079273365 11:19010067-19010089 CTGGCTTCATAGAATGAACTAGG + Intergenic
1079636188 11:22744284-22744306 CTGGTTTTACAGAATGAACTTGG - Intronic
1080430194 11:32190703-32190725 CAGGGTGCTCAGGAAGAACTTGG + Intergenic
1080620186 11:33980803-33980825 CAGTTGTCACAGAAGGAAGTTGG - Intergenic
1081169051 11:39844466-39844488 CAGTTTTCACTTAAGGAACTAGG - Intergenic
1081678106 11:44982793-44982815 CATGGTCCACAGATGCAACTGGG - Intergenic
1083155147 11:60818271-60818293 TAGAGTTGGCAGAAGGAACTGGG - Intergenic
1085405183 11:76257394-76257416 CAGGGATTCCAGGAGGAACTGGG - Intergenic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1086551405 11:88056934-88056956 CAGGAATCACTGAAGAAACTGGG - Intergenic
1088206733 11:107400701-107400723 CTGGCTTCACAGAATGAATTAGG - Intronic
1088395909 11:109369338-109369360 CTGGCTTCACAGAATGAGCTAGG + Intergenic
1090757600 11:129806945-129806967 CTGGCTTCACAGAATGAATTAGG - Intergenic
1092024840 12:5231898-5231920 CAGGGCTCACAGGAGGGGCTCGG - Intergenic
1092399404 12:8161308-8161330 CTGGCTTCACAGAATAAACTAGG + Intronic
1093408914 12:18841744-18841766 CAGGCTTCATAGAATGAATTGGG + Intergenic
1094066364 12:26364820-26364842 CAGGGTACACAGAACAAATTGGG - Intronic
1094795139 12:33963308-33963330 CCTGCTTCACAGAAGGAGCTAGG + Intergenic
1095107770 12:38256404-38256426 CCTGCTTCACAGAAGGAGCTAGG + Intergenic
1095370316 12:41459014-41459036 CAGAGTTCAAAGGAGGAATTAGG + Intronic
1096243319 12:49970990-49971012 CAGGGAGAACAGAAGGAAATGGG + Intronic
1096387423 12:51204107-51204129 CAGGGACCACAGGAGGGACTTGG + Intronic
1096817145 12:54208808-54208830 CAGGGTTCAAAGGAGGGGCTGGG - Intergenic
1097687918 12:62708438-62708460 CAGGTTTCCCAGCAGGAAATTGG - Intronic
1097781157 12:63706706-63706728 TAGAGTTCAGAGAAGCAACTGGG + Intergenic
1100819313 12:98416540-98416562 CAGGGAGCACTCAAGGAACTGGG + Intergenic
1101649143 12:106659040-106659062 CAGGGGTCAGGGAAGGAAGTGGG - Intronic
1102356504 12:112241294-112241316 CAGGGTGCCCAGAAAGAAATAGG - Intronic
1102576904 12:113861357-113861379 CAGTGTGGGCAGAAGGAACTGGG - Intronic
1102661964 12:114536891-114536913 AAGGCTTTTCAGAAGGAACTTGG + Intergenic
1102665721 12:114571136-114571158 CAAGGTTTTCAGAAGGAGCTTGG - Intergenic
1104239601 12:126975078-126975100 CAGGGTGCAGAGCAGGAAGTAGG + Intergenic
1104316360 12:127706143-127706165 CAGAAATCACAGAAGGAACCCGG - Intergenic
1104373273 12:128243034-128243056 CAGAGTGCAAAAAAGGAACTGGG - Intergenic
1105847348 13:24304748-24304770 GATGGTCCACAGAAGCAACTCGG - Exonic
1107755684 13:43619756-43619778 CTGGCTTCACAGAATGAATTAGG + Intronic
1107903168 13:45038408-45038430 CAGGGTACACAGAATCACCTGGG - Intergenic
1108052558 13:46460735-46460757 GAAGGGTCACAGAAGAAACTAGG - Intergenic
1108207393 13:48104530-48104552 GAGGTTTGACTGAAGGAACTAGG - Intergenic
1108825857 13:54411431-54411453 CTGGCTTCACAGAATGAATTAGG - Intergenic
1109508083 13:63333405-63333427 CTGGCTTCACAGAATGAATTAGG + Intergenic
1112872997 13:103997655-103997677 CAGGATTCACAGAAAGGCCTTGG + Intergenic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1115790742 14:36875088-36875110 GAGGGTTCAGATAAAGAACTTGG + Intronic
1115981786 14:39060172-39060194 CAGATTTCAGATAAGGAACTTGG - Intronic
1116779523 14:49221015-49221037 CAGAGTTCTGAGAAAGAACTAGG - Intergenic
1117379597 14:55147356-55147378 CAAGGATAACAGAATGAACTAGG + Intergenic
1117447292 14:55816333-55816355 GAGGGCTCACAGAGGGAGCTGGG - Intergenic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1120237904 14:81913887-81913909 CAGGCTTCATAGAATGAATTTGG + Intergenic
1121722812 14:96122765-96122787 CATGATTCACAGAAGGGGCTGGG + Intergenic
1123766165 15:23480461-23480483 CTGGCTTCATAGAATGAACTAGG + Intergenic
1123781031 15:23628769-23628791 TAGGGTAAACAGAAGTAACTGGG - Intronic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1124386455 15:29211981-29212003 CTGGCTTCACAGAATGAATTAGG + Intronic
1124452314 15:29806526-29806548 CTTTGCTCACAGAAGGAACTTGG - Intronic
1125273161 15:37962543-37962565 CTGGCTTCACAGAATGAATTGGG + Intronic
1125672972 15:41486695-41486717 CAGAGCTCACAGATGGAATTAGG + Intergenic
1125846721 15:42862221-42862243 CAGGTTTCATAGAATGAATTAGG - Intronic
1128333685 15:66772800-66772822 CAGGGTTAAAAGAATGGACTAGG - Intronic
1128828552 15:70744635-70744657 CAGGGGTGACAGAAGAAAATGGG + Intronic
1130316758 15:82802875-82802897 CCAGGGTCACAGAAGGACCTAGG - Intronic
1131136025 15:89936382-89936404 CAGGCATCACAGTAGGAACAAGG + Intergenic
1132773478 16:1578335-1578357 CTGGGTCCCAAGAAGGAACTTGG + Intronic
1134234933 16:12458196-12458218 CTGGGCTCACAGATGGAACGTGG - Intronic
1135264389 16:21010139-21010161 CTGGGCACACAGAAGGCACTTGG + Intronic
1135885437 16:26301913-26301935 CTGGGCTCAGAGAAGGCACTGGG - Intergenic
1136040937 16:27578370-27578392 CAGGGTACAAAGAAGCACCTGGG - Intronic
1138901052 16:61271011-61271033 CAGAGTTCACTCAAAGAACTTGG - Intergenic
1141371821 16:83494617-83494639 CAGTGTCCAGAGCAGGAACTGGG + Intronic
1142406511 16:89893195-89893217 CAGGTTTATCAGAAGAAACTGGG + Intronic
1143505333 17:7361475-7361497 AAGGGTTCAGAGAAGGGGCTGGG + Intergenic
1143978632 17:10848610-10848632 CAGTGACCACAGAAGGAACTTGG + Intergenic
1144612732 17:16737637-16737659 CAGGATTCAAAGAAGAAATTGGG + Intronic
1144900053 17:18577956-18577978 CAGGATTCAAAGAAGAAATTGGG - Intergenic
1145132391 17:20367712-20367734 CAGGATTCAAAGAAGAAATTGGG + Intergenic
1147677544 17:42218557-42218579 CAGTGTCCACAGGAGAAACTGGG + Intronic
1147688496 17:42301027-42301049 CAGTGTCCACAGGAGAAACTGGG - Intronic
1148264569 17:46215275-46215297 CAGGGTTCACAGAAGGAACTGGG + Intronic
1148824545 17:50382798-50382820 CAGGGTTCCCTGAAGGAATGAGG - Exonic
1150225287 17:63521413-63521435 CATGGTGCACAAAAGGGACTTGG + Intronic
1150234628 17:63583033-63583055 CAGGTTTCACAGAATCAGCTTGG + Intronic
1150613426 17:66751331-66751353 CAGGGCTCACAGATGGCACATGG + Intronic
1151095895 17:71497818-71497840 CAGGGCTCACAGATGGACCCTGG + Intergenic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1151817172 17:76477083-76477105 CAGGGTGCTCAGAAGGGGCTTGG + Intronic
1156553134 18:38039633-38039655 CAGGGCTCCCACAAGGCACTGGG - Intergenic
1156986356 18:43355352-43355374 CAGGGTCAACAGTAGGATCTGGG - Intergenic
1157318895 18:46619318-46619340 CAGGGCTCAGAGAAGGCACTAGG - Intronic
1159893200 18:73972333-73972355 CAGGGTCCCCAGAAGTAACTGGG - Intergenic
1161164723 19:2780231-2780253 GAGTGTTCACAGAAGGTAGTGGG - Intronic
1162222698 19:9191752-9191774 GAAGGGTCACAGAAGAAACTGGG - Intergenic
1163040289 19:14597052-14597074 GAGGGTGCACAGGAGGACCTGGG + Intronic
1164298914 19:23941483-23941505 CTGGCTTCACAGAATGAATTAGG + Intronic
1166595050 19:44039611-44039633 CTGGCCTCAGAGAAGGAACTAGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167526347 19:49986593-49986615 CATGGTTGAGAGAAGGAAGTTGG + Intronic
1167671483 19:50856188-50856210 CAGGGTTGACAGGAGGAACTGGG - Intronic
1168129003 19:54305524-54305546 CGGGGGTCACAGAAGGTGCTGGG - Intergenic
1202674042 1_KI270710v1_random:24094-24116 AAGGGGTGACAGAAGGAACCTGG - Intergenic
925024881 2:599815-599837 CAGAGTCCACAGCAGGACCTGGG - Intergenic
926636136 2:15181848-15181870 CAGGGCCTACAGCAGGAACTAGG + Intronic
926891575 2:17643758-17643780 CAAGGTTTAAAGAAGGAACAGGG + Intronic
927484310 2:23478353-23478375 CAGGGGTCACAGAACCATCTAGG - Intronic
927520064 2:23693173-23693195 GTGGGTTCAGAGAAGGATCTAGG + Intronic
927712096 2:25332382-25332404 CAGGGCTCAGAGAAGGAAGTCGG - Intronic
928734009 2:34264629-34264651 CTGGCTTCACAGAATGAATTAGG - Intergenic
930243876 2:48963609-48963631 CAGGTTGCACATAAGGAACCTGG + Exonic
931135566 2:59395731-59395753 CAGGCTTCACAGAAGGAGCCTGG - Intergenic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
935859583 2:107313977-107313999 CTGGTCTCACAGAATGAACTAGG + Intergenic
942544171 2:177045243-177045265 AAAGGTTCAAAGAAGGAACAGGG + Intergenic
945470617 2:210224763-210224785 CCGGGTTCACAGCTCGAACTGGG + Intronic
946982849 2:225236787-225236809 CAGGGCTCAGAGAACGCACTGGG + Intergenic
947456761 2:230261958-230261980 CTGGCTTCACAGAATGAATTAGG + Intronic
947917076 2:233839593-233839615 CAGGCACCACAGAAGGAACAAGG + Intronic
948036726 2:234863790-234863812 CAGGGGTCAGAGAAGCACCTGGG + Intergenic
948443230 2:238011280-238011302 CAGGGTTCACGGAACATACTAGG + Intronic
1169105008 20:2987271-2987293 CAGGGGTCCCAGAAGGGTCTGGG - Intronic
1169147279 20:3261015-3261037 CACCTGTCACAGAAGGAACTGGG + Intronic
1169540649 20:6595894-6595916 GAGGGTTCAGCCAAGGAACTGGG + Intergenic
1170562161 20:17567898-17567920 CTGGGATTATAGAAGGAACTAGG + Intronic
1170758394 20:19225604-19225626 CAGGGTTCAGAGATGGAAGAAGG - Intronic
1171335966 20:24385873-24385895 AAATGTTCTCAGAAGGAACTTGG + Intergenic
1172234184 20:33358731-33358753 CAGTGTCCACAGGAGAAACTGGG + Intergenic
1172894724 20:38292477-38292499 CAAGGTGCACAGTAGGCACTTGG + Intronic
1173166017 20:40687873-40687895 CACGACTCACAGAAAGAACTCGG + Exonic
1173844381 20:46178725-46178747 CTGGGTCCTCAGAAGGGACTGGG + Intronic
1175575399 20:60057111-60057133 CAGGGGTCACAGGAGCACCTGGG + Intronic
1176926038 21:14750107-14750129 CAAGTTTCAGAGAATGAACTGGG + Intergenic
1177220300 21:18183746-18183768 CATGGTTCACTTAAGTAACTGGG + Intronic
1177847622 21:26309184-26309206 CTGGCTTCACAGAATGAATTAGG - Intergenic
1178689752 21:34741132-34741154 CAGTAATCACAGAAGGAAATTGG - Intergenic
1180725753 22:17945550-17945572 CAGGATTCACATGAGGACCTGGG + Intronic
1181936536 22:26442891-26442913 CAGGGTGGACAAAAGGAAATGGG - Intronic
1181963088 22:26637157-26637179 CAGGGTACACACAAAGAACTTGG + Intergenic
1183177129 22:36232594-36232616 CAGGTCACACAGAAGGGACTTGG + Intronic
1185116468 22:48941040-48941062 CAGGGCTCACAGTAGGAGCCAGG + Intergenic
949352956 3:3144210-3144232 CAGGATTAACAGAAGAAACGAGG - Intronic
950723657 3:14901942-14901964 CAGGGTTCAGAGAAGGGAGGTGG + Intronic
950833033 3:15893915-15893937 CAAGGTTGCCAGAAAGAACTCGG - Intergenic
954129744 3:48554367-48554389 CAGGGTTCACAGCAGGGAGTGGG - Intronic
954339443 3:49941046-49941068 CAGGGTTCAGAAAATGAACCAGG - Intronic
956326348 3:68056933-68056955 CAGGGGTCACAAATGGATCTGGG - Intronic
958812046 3:98871779-98871801 CCGGGTTCATAGAAAGAATTAGG + Intronic
958977252 3:100682267-100682289 GAGGGTCCCCAGGAGGAACTGGG + Intronic
959059051 3:101599494-101599516 CAGGGTTCATAGAAGGTTCAAGG - Intergenic
959561271 3:107785301-107785323 CAGGTCTCACAGAATGAATTGGG - Intronic
959899408 3:111642957-111642979 CTGGCTTCACAGAATGAATTAGG - Intronic
961174507 3:124822752-124822774 CAGGCCCCACAGAAGGCACTGGG + Intronic
961793977 3:129396366-129396388 CAGGGTTCATAGAAGGTTCAAGG - Intergenic
963848448 3:150183101-150183123 CTGGGCTCAGAGAAGGATCTAGG + Intergenic
964075940 3:152691935-152691957 CTGGCTTCACAGAATGATCTAGG - Intergenic
966020600 3:175204081-175204103 CTGGCTTCACAGAATGAATTAGG - Intronic
966522360 3:180887925-180887947 CAGGGTTCATAGAAGGTTCAAGG - Intronic
969611210 4:8228653-8228675 GAAGGCACACAGAAGGAACTGGG - Intronic
969731621 4:8960922-8960944 CAGGGTTCACCGGAGGAGATGGG - Intergenic
971448701 4:26779555-26779577 CAGGCTTCCCAGCAGCAACTGGG + Intergenic
974180332 4:58376275-58376297 CTGGTTTCACAGAATGAATTAGG + Intergenic
977552136 4:98453308-98453330 CTGGCTTCACAGAATGACCTAGG + Intergenic
978537852 4:109781645-109781667 CTGGCTTCACAGAATGAATTGGG - Intronic
978799190 4:112738800-112738822 CAGGGTTCATAGAAGGTTCAAGG + Intergenic
978843463 4:113244257-113244279 CAGGGTTCACAGCACCAAGTAGG - Intronic
979664178 4:123292921-123292943 CAGCCTTGACAGAAGCAACTGGG + Intronic
979976472 4:127202610-127202632 AAGATTTCACAGGAGGAACTGGG - Intergenic
980152910 4:129070261-129070283 CTGGCTTCACAGAATGAATTAGG + Intronic
980710494 4:136560173-136560195 CCAGGTTCTCAGAAAGAACTGGG + Intergenic
980718103 4:136654623-136654645 CAGTCTTTACAGAAGGCACTGGG - Intergenic
981156243 4:141440236-141440258 CAGGGTTTGCAGAAAGAATTCGG - Intergenic
982064806 4:151644790-151644812 CAGGGTGCACAGCAGGAACAGGG - Intronic
982630936 4:157828210-157828232 CTGGCTTCACAGAATGAATTAGG - Intergenic
984279334 4:177650141-177650163 CAGGGTTCACAGATGGACATAGG - Intergenic
984702312 4:182826131-182826153 CAGGGCTCACAGAAGGGCCCTGG - Intergenic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
985802494 5:2013890-2013912 CAGGGTTCACTGTCGGAAGTGGG - Intergenic
986732995 5:10649112-10649134 CAGGGTTCGCAGAGTGAACTAGG + Intronic
987604963 5:20122170-20122192 TAGCGTTCCCTGAAGGAACTAGG - Intronic
987855318 5:23413000-23413022 CAGGGTCCACGGAAGTCACTGGG + Intergenic
989369547 5:40691856-40691878 TGGGGTTCACAGAAGCAATTCGG - Exonic
990478414 5:56184414-56184436 CAGGGCTGAAAGAATGAACTAGG - Intronic
992984166 5:82210641-82210663 CATGGTTCCCACTAGGAACTAGG - Intronic
993563204 5:89438318-89438340 CTGGGTTCAAAGTAGTAACTGGG - Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
997271181 5:132539460-132539482 CAGCGTTCACAGAAGACAATCGG + Intergenic
997732461 5:136191565-136191587 CCGTGCTCACAGAAGAAACTGGG + Intergenic
998744557 5:145243372-145243394 CAGGGTTAACAGAATGAAAAGGG + Intergenic
999668564 5:153937711-153937733 CAGGTCTCACTGCAGGAACTTGG + Intergenic
1000314571 5:160076703-160076725 CAGGATTAACAGAAGGTTCTGGG - Intronic
1001949486 5:175806239-175806261 CATGGTTTACTGAGGGAACTGGG - Intronic
1001994746 5:176147547-176147569 CAGAGTCCCAAGAAGGAACTCGG - Intergenic
1005808879 6:29501363-29501385 CAGGGTTCTAGGAAGGAACCTGG - Intergenic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1007263186 6:40577990-40578012 CAGGGGGCACAGAAGGGACGGGG - Intronic
1007381422 6:41492627-41492649 TTGGTTTCACAGAAGGCACTTGG + Intergenic
1007961873 6:45967433-45967455 AAGGGTTCACGGAAGGATTTGGG + Intronic
1008054024 6:46928128-46928150 CAGGATTCACAGCAGGCATTTGG - Intronic
1008807528 6:55450006-55450028 CTGAGTTCCCTGAAGGAACTTGG + Intronic
1011862563 6:91778270-91778292 CAGTGATCACAGAAGAAACCAGG + Intergenic
1013752297 6:113421495-113421517 CCTGGTTTACAGAAGAAACTTGG - Intergenic
1013946157 6:115725081-115725103 CAGGCTTCACAGAATGATTTAGG + Intergenic
1014330480 6:120057753-120057775 CTGGCTTCACAGAATGAATTTGG - Intergenic
1014783334 6:125589488-125589510 CATGGCTAACAGAAGGAGCTGGG - Intergenic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1017238630 6:152143197-152143219 CTGGGTTCACCGAATGACCTTGG - Intronic
1018028433 6:159823205-159823227 CAGAATCCACAGAAGGAGCTTGG - Intergenic
1018936194 6:168275445-168275467 CCTGTTTCAGAGAAGGAACTGGG + Intergenic
1019390666 7:784780-784802 CAGGTTTCACAGGAGCAAATAGG - Intronic
1020824237 7:13007464-13007486 CAGAGACCACAGAAGGAATTTGG - Intergenic
1022412245 7:30148376-30148398 CAGGAGTCACAGAAGGACATGGG + Intronic
1022790584 7:33684933-33684955 CACTCTTCACAGAAGGATCTAGG - Intergenic
1023409116 7:39870674-39870696 CAAGATTCAAAGAAGGAATTAGG + Intergenic
1023701571 7:42896726-42896748 CTGGCTTCACAGAATGAATTAGG - Intergenic
1024668994 7:51574304-51574326 CTGGGTTCATAGAATGAATTAGG + Intergenic
1024984802 7:55185750-55185772 CAGGGTTCTCAGAATGAAACTGG + Intronic
1025043814 7:55673355-55673377 CAAGATTCAAAGAAGGAATTAGG - Intergenic
1025136741 7:56421876-56421898 CAAGATTCAAAGAAGGAATTAGG - Intergenic
1026479032 7:70763072-70763094 CAGGGTCCGGAGAAGGAGCTCGG - Exonic
1026652319 7:72226302-72226324 CATGGTTCAGAGAAGCATCTCGG - Intronic
1028662592 7:93297513-93297535 CAAGGTTCACAGAAAGAATTTGG + Intronic
1029335343 7:99894261-99894283 CAGGCCTCACAGAAAGAATTGGG + Intronic
1030524854 7:110640661-110640683 AGGGGTTCAGAGAAGGAATTAGG - Intergenic
1032534771 7:132653592-132653614 CAGGTTTCACAGCAGCAGCTTGG - Intronic
1032645503 7:133819191-133819213 CAGGGTTGAAAGCAGGAACAAGG - Intronic
1033726397 7:144123295-144123317 AAGGGTTTACAGATGGAAATGGG + Intergenic
1034225433 7:149477505-149477527 CAGGGATCACAGGAGGGACAGGG - Intronic
1035263538 7:157676208-157676230 CAGGGCTGCCAGGAGGAACTGGG - Intronic
1035419166 7:158712544-158712566 CGGGGTTCACACCAGGAAGTTGG + Intergenic
1037824846 8:22155021-22155043 CAGAGTTCCCAGAAAGAGCTGGG - Intronic
1038366946 8:26946121-26946143 CTGGCTTCATAGAAGGAATTAGG + Intergenic
1038822256 8:30963609-30963631 CATGGATAATAGAAGGAACTGGG + Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1040100431 8:43496241-43496263 CAAGATTCAAAGAAGGAATTAGG + Intergenic
1042609336 8:70580191-70580213 CTGGCTTCATAGAATGAACTGGG - Intronic
1043121374 8:76329439-76329461 CTGGCTTCACAGAATGAATTAGG + Intergenic
1043169885 8:76952478-76952500 GAGGGTTAGCAGAAGGAACTTGG + Intergenic
1047576517 8:126161676-126161698 CAGAGTACACAGGAGAAACTTGG + Intergenic
1047816971 8:128475284-128475306 CAGTGTTCCCAGAAGAAACCAGG + Intergenic
1049238493 8:141524703-141524725 CAGGCCTGACGGAAGGAACTCGG + Intergenic
1050891247 9:10827295-10827317 CTGGCTTCACAGAAGGATTTGGG + Intergenic
1051733489 9:20172834-20172856 CAGGCTTCACAGAATGATTTAGG - Intergenic
1051881444 9:21844365-21844387 CTGGCTTCACAGAATGAATTAGG - Intronic
1053195763 9:36117264-36117286 CAGGATTCACAGAAGACCCTCGG - Intronic
1056322430 9:85448895-85448917 CTGGCTTCACAGAATGAATTAGG + Intergenic
1056469799 9:86894289-86894311 CAGCGTTCCCAAAAGGAGCTGGG - Intergenic
1057554352 9:96075765-96075787 CAAGTTTCACAGAAGCAGCTGGG - Intergenic
1057638258 9:96792123-96792145 CTGGCCTCACAGAATGAACTGGG + Intergenic
1057996530 9:99824761-99824783 CAGGCCTCAGGGAAGGAACTGGG - Intronic
1059585004 9:115596452-115596474 CTGGGTTCAGAGATGGAACTTGG + Intergenic
1060383528 9:123200421-123200443 CTGGTTTCACAGAATGATCTAGG + Intronic
1061619282 9:131800930-131800952 CAGGGTGCACAGCAGGCAGTGGG - Intergenic
1185823231 X:3224874-3224896 CAGGGTTCACAGAAGGAATGAGG + Intergenic
1188074571 X:25759375-25759397 AAGGGTTCAGAGAAGGAGCGAGG + Intergenic
1189592864 X:42534131-42534153 CAGAGTTCACAGTAGGATCAGGG + Intergenic
1189878854 X:45467987-45468009 CTGGCTTCACAGAATGAATTAGG + Intergenic
1190149138 X:47927935-47927957 CTGGGCTCACAGAATGAATTGGG + Intronic
1191600158 X:62994755-62994777 CAGGGTTCTCAGAAGGTCTTTGG + Intergenic
1194557178 X:95374559-95374581 CTGGCTTCACAGAATGAATTAGG - Intergenic
1195387894 X:104330347-104330369 CAGGGGTCATGGAAGTAACTGGG + Intergenic
1195680016 X:107538390-107538412 CTGTGTTCACAGCAGGCACTTGG + Intronic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1200001996 X:153066929-153066951 CAAGATTCACAGAAGGCTCTGGG - Intergenic
1200005736 X:153083096-153083118 CAAGATTCACAGAAGGCTCTGGG + Intergenic
1201256162 Y:12110280-12110302 CAGGGTTTGCAGAAGGAATGAGG - Intergenic