ID: 1148265773

View in Genome Browser
Species Human (GRCh38)
Location 17:46225082-46225104
Sequence CAGCGCCCACTCGTAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148265773 Original CRISPR CAGCGCCCACTCGTAGGCCT GGG (reversed) Intronic
900192660 1:1358078-1358100 CAGCCCCCGCTCCCAGGCCTGGG - Intronic
901250116 1:7771510-7771532 CACCGCCCACCCCCAGGCCTCGG - Intronic
904377509 1:30090897-30090919 CAGCAGCCCCTCGTAGCCCTGGG - Intergenic
909075502 1:71047107-71047129 CAGCGCCCGCTCGACGGCCATGG + Exonic
915262681 1:154689398-154689420 CAGCCCCCTGCCGTAGGCCTTGG + Intergenic
922118236 1:222635313-222635335 CAGAGCCCTCTTCTAGGCCTGGG + Intronic
1073214953 10:101830970-101830992 ATGCGCACACTCGCAGGCCTGGG + Intronic
1075819382 10:125292738-125292760 CAGCACCCACTCGTATGCTGCGG - Intergenic
1081809716 11:45908005-45908027 CACCGTCCCCTCGCAGGCCTGGG + Intergenic
1090186256 11:124740749-124740771 CAGCGCCCACGCGGAAACCTGGG + Intronic
1102050039 12:109855658-109855680 GAGGGCCATCTCGTAGGCCTTGG + Exonic
1102924299 12:116815155-116815177 CAGAGGCCACTCCCAGGCCTGGG + Intronic
1116319737 14:43446368-43446390 CACCACCCTCTAGTAGGCCTGGG + Intergenic
1126866905 15:52946719-52946741 GAGGGCCCACACTTAGGCCTTGG + Intergenic
1131272387 15:90955177-90955199 CAGGGCCCCGGCGTAGGCCTCGG + Intronic
1132735194 16:1382471-1382493 CAGCGCCCAGTGGTGGGGCTTGG - Intronic
1133103613 16:3493697-3493719 CAGCGCCCAGGCCTGGGCCTCGG - Exonic
1139775728 16:69316051-69316073 CAGCGCCTCCTCGTAGTTCTTGG - Exonic
1144756156 17:17681763-17681785 CCGCGCTCACTCGGGGGCCTTGG - Exonic
1145275503 17:21426983-21427005 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145313355 17:21712877-21712899 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145711802 17:26984833-26984855 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145935200 17:28711189-28711211 CAGCGCCCACCCGGACGCCGGGG - Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148371005 17:47100015-47100037 CAGCTCCCACTTGCAGACCTGGG - Intergenic
1152892301 17:82889384-82889406 CAGCACCCACGCGGAGGCCCCGG - Intronic
1157816806 18:50735369-50735391 CAGAGCCTGCTAGTAGGCCTGGG + Intergenic
1162162854 19:8731603-8731625 CAGCGCCATCTCGTAGGCACAGG - Exonic
1162799398 19:13102678-13102700 CCGCGCCTCCTCGTGGGCCTCGG + Exonic
926085866 2:10020058-10020080 CAGCGGCCACCCGTTGTCCTGGG - Intergenic
928364683 2:30691889-30691911 CAGCCCCCACTCAGAGGCCTTGG + Intergenic
943520574 2:188944487-188944509 CAGCGCCCACTGGTGAGGCTCGG + Intergenic
1172023841 20:31934687-31934709 CAGCGTCCACTTGCAGCCCTGGG - Exonic
1174764540 20:53240299-53240321 CAGCGCCCACACATAGACCTGGG + Intronic
1176285485 21:5016875-5016897 CAGCGCCCACTGGGTGGCCCCGG - Intergenic
1179871696 21:44246600-44246622 CAGCGCCCACTGGGTGGCCCCGG + Intronic
1180607123 22:17067200-17067222 CAACGCCCACTGGGAGCCCTTGG - Intergenic
1181057932 22:20268557-20268579 CAGAGGCCATTCCTAGGCCTCGG - Intronic
1182857935 22:33534667-33534689 CAGCCCCGCCTCGGAGGCCTGGG - Intronic
1184099354 22:42333921-42333943 CAGGGGCCACCCGTTGGCCTGGG - Intronic
953356466 3:42260359-42260381 GAGTGCCCACTCTAAGGCCTGGG + Intronic
954320414 3:49828902-49828924 CAGCTCCCAGTCGTAGGAGTGGG + Exonic
957555567 3:81761464-81761486 GAGCGCCGCCTCGTAGTCCTCGG + Exonic
960056153 3:113278035-113278057 CATAGCCCACTCGTAGCCCGAGG + Intronic
968631765 4:1655567-1655589 CCGCGCCCAGGCGCAGGCCTGGG - Exonic
969459659 4:7322242-7322264 CTGCTCCCACTCTCAGGCCTGGG - Intronic
969540837 4:7787935-7787957 CAGCACCCACGCGGAGACCTGGG - Intronic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
993640025 5:90391261-90391283 CAGCTACCACCCCTAGGCCTAGG - Intergenic
1002633435 5:180595625-180595647 CAGCGCCCTCTCGTCAGCCTGGG + Intergenic
1003742640 6:8960632-8960654 CAGCACCTAGTCGTAGGCCTGGG + Intergenic
1004194184 6:13488611-13488633 CAGTGCCCCCTCGAGGGCCTGGG - Intergenic
1006410912 6:33872743-33872765 CAGCCCCCACCTGTGGGCCTTGG - Intergenic
1007607163 6:43125378-43125400 CAGCACCCACTCCTGGGGCTGGG - Intronic
1023688346 7:42760262-42760284 CAGCTCCCACTCTTAGGACATGG - Intergenic
1035297720 7:157876645-157876667 CAGCGCCCCCACGTGGGGCTGGG + Intronic
1035382480 7:158448614-158448636 CAGCTCCCACTCCTGGGCCAAGG + Intronic
1045109610 8:98927804-98927826 CAGCTCCCACTCTGTGGCCTAGG - Intronic
1048482306 8:134809894-134809916 CAGTGCCCACTCAAAGACCTAGG + Intergenic
1049709824 8:144058453-144058475 CACTGCCCACTCCTGGGCCTGGG - Intronic
1053200533 9:36148916-36148938 CAACCCCCACTCCTCGGCCTGGG - Intronic
1061912868 9:133734137-133734159 CAGCAGCCACACGTAGGGCTCGG + Exonic
1062218695 9:135402980-135403002 AAGCACCCAGTCGTTGGCCTGGG - Intergenic
1187400365 X:18954254-18954276 CTGCTCCAGCTCGTAGGCCTTGG + Exonic
1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG + Intergenic