ID: 1148268310

View in Genome Browser
Species Human (GRCh38)
Location 17:46243853-46243875
Sequence CTGCGGAAAGAGGTTGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148268310_1148268315 17 Left 1148268310 17:46243853-46243875 CCACGCTCAACCTCTTTCCGCAG No data
Right 1148268315 17:46243893-46243915 CACACTGAATAATAATTCTCTGG No data
1148268310_1148268313 -7 Left 1148268310 17:46243853-46243875 CCACGCTCAACCTCTTTCCGCAG No data
Right 1148268313 17:46243869-46243891 TCCGCAGGTGCAGTTGTCTCAGG No data
1148268310_1148268316 18 Left 1148268310 17:46243853-46243875 CCACGCTCAACCTCTTTCCGCAG No data
Right 1148268316 17:46243894-46243916 ACACTGAATAATAATTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148268310 Original CRISPR CTGCGGAAAGAGGTTGAGCG TGG (reversed) Intergenic
No off target data available for this crispr