ID: 1148268310 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:46243853-46243875 |
| Sequence | CTGCGGAAAGAGGTTGAGCG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1148268310_1148268315 | 17 | Left | 1148268310 | 17:46243853-46243875 | CCACGCTCAACCTCTTTCCGCAG | No data | ||
| Right | 1148268315 | 17:46243893-46243915 | CACACTGAATAATAATTCTCTGG | No data | ||||
| 1148268310_1148268313 | -7 | Left | 1148268310 | 17:46243853-46243875 | CCACGCTCAACCTCTTTCCGCAG | No data | ||
| Right | 1148268313 | 17:46243869-46243891 | TCCGCAGGTGCAGTTGTCTCAGG | No data | ||||
| 1148268310_1148268316 | 18 | Left | 1148268310 | 17:46243853-46243875 | CCACGCTCAACCTCTTTCCGCAG | No data | ||
| Right | 1148268316 | 17:46243894-46243916 | ACACTGAATAATAATTCTCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1148268310 | Original CRISPR | CTGCGGAAAGAGGTTGAGCG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||