ID: 1148270781

View in Genome Browser
Species Human (GRCh38)
Location 17:46260297-46260319
Sequence CATATGCCCGCTGCAGCTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148270781_1148270786 15 Left 1148270781 17:46260297-46260319 CCGCGAGCTGCAGCGGGCATATG No data
Right 1148270786 17:46260335-46260357 GGCCGCTGAAGGTCATCATCAGG No data
1148270781_1148270784 4 Left 1148270781 17:46260297-46260319 CCGCGAGCTGCAGCGGGCATATG No data
Right 1148270784 17:46260324-46260346 GCCGCGGTTCAGGCCGCTGAAGG No data
1148270781_1148270783 -6 Left 1148270781 17:46260297-46260319 CCGCGAGCTGCAGCGGGCATATG No data
Right 1148270783 17:46260314-46260336 CATATGCGAAGCCGCGGTTCAGG No data
1148270781_1148270788 18 Left 1148270781 17:46260297-46260319 CCGCGAGCTGCAGCGGGCATATG No data
Right 1148270788 17:46260338-46260360 CGCTGAAGGTCATCATCAGGCGG No data
1148270781_1148270789 30 Left 1148270781 17:46260297-46260319 CCGCGAGCTGCAGCGGGCATATG No data
Right 1148270789 17:46260350-46260372 TCATCAGGCGGAACTCGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148270781 Original CRISPR CATATGCCCGCTGCAGCTCG CGG (reversed) Intergenic
No off target data available for this crispr