ID: 1148270787

View in Genome Browser
Species Human (GRCh38)
Location 17:46260337-46260359
Sequence CGCCTGATGATGACCTTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148270787_1148270791 5 Left 1148270787 17:46260337-46260359 CCGCTGAAGGTCATCATCAGGCG No data
Right 1148270791 17:46260365-46260387 CGTAGAGGCGGCCCACGCGCTGG No data
1148270787_1148270795 22 Left 1148270787 17:46260337-46260359 CCGCTGAAGGTCATCATCAGGCG No data
Right 1148270795 17:46260382-46260404 CGCTGGAACAGCAGGATAGCTGG No data
1148270787_1148270790 -7 Left 1148270787 17:46260337-46260359 CCGCTGAAGGTCATCATCAGGCG No data
Right 1148270790 17:46260353-46260375 TCAGGCGGAACTCGTAGAGGCGG No data
1148270787_1148270789 -10 Left 1148270787 17:46260337-46260359 CCGCTGAAGGTCATCATCAGGCG No data
Right 1148270789 17:46260350-46260372 TCATCAGGCGGAACTCGTAGAGG No data
1148270787_1148270792 14 Left 1148270787 17:46260337-46260359 CCGCTGAAGGTCATCATCAGGCG No data
Right 1148270792 17:46260374-46260396 GGCCCACGCGCTGGAACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148270787 Original CRISPR CGCCTGATGATGACCTTCAG CGG (reversed) Intergenic
No off target data available for this crispr