ID: 1148270789

View in Genome Browser
Species Human (GRCh38)
Location 17:46260350-46260372
Sequence TCATCAGGCGGAACTCGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148270785_1148270789 2 Left 1148270785 17:46260325-46260347 CCGCGGTTCAGGCCGCTGAAGGT No data
Right 1148270789 17:46260350-46260372 TCATCAGGCGGAACTCGTAGAGG No data
1148270781_1148270789 30 Left 1148270781 17:46260297-46260319 CCGCGAGCTGCAGCGGGCATATG No data
Right 1148270789 17:46260350-46260372 TCATCAGGCGGAACTCGTAGAGG No data
1148270787_1148270789 -10 Left 1148270787 17:46260337-46260359 CCGCTGAAGGTCATCATCAGGCG No data
Right 1148270789 17:46260350-46260372 TCATCAGGCGGAACTCGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148270789 Original CRISPR TCATCAGGCGGAACTCGTAG AGG Intergenic
No off target data available for this crispr