ID: 1148271710

View in Genome Browser
Species Human (GRCh38)
Location 17:46266844-46266866
Sequence ACCGCGCGTCGCCGCGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148271703_1148271710 8 Left 1148271703 17:46266813-46266835 CCCACAGGCCCGCGCCTGGCGCA No data
Right 1148271710 17:46266844-46266866 ACCGCGCGTCGCCGCGCCGCGGG No data
1148271704_1148271710 7 Left 1148271704 17:46266814-46266836 CCACAGGCCCGCGCCTGGCGCAA No data
Right 1148271710 17:46266844-46266866 ACCGCGCGTCGCCGCGCCGCGGG No data
1148271701_1148271710 19 Left 1148271701 17:46266802-46266824 CCGCACACGCTCCCACAGGCCCG No data
Right 1148271710 17:46266844-46266866 ACCGCGCGTCGCCGCGCCGCGGG No data
1148271705_1148271710 0 Left 1148271705 17:46266821-46266843 CCCGCGCCTGGCGCAAGCCGAGA No data
Right 1148271710 17:46266844-46266866 ACCGCGCGTCGCCGCGCCGCGGG No data
1148271699_1148271710 27 Left 1148271699 17:46266794-46266816 CCGTGAGGCCGCACACGCTCCCA No data
Right 1148271710 17:46266844-46266866 ACCGCGCGTCGCCGCGCCGCGGG No data
1148271706_1148271710 -1 Left 1148271706 17:46266822-46266844 CCGCGCCTGGCGCAAGCCGAGAA No data
Right 1148271710 17:46266844-46266866 ACCGCGCGTCGCCGCGCCGCGGG No data
1148271707_1148271710 -6 Left 1148271707 17:46266827-46266849 CCTGGCGCAAGCCGAGAACCGCG No data
Right 1148271710 17:46266844-46266866 ACCGCGCGTCGCCGCGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148271710 Original CRISPR ACCGCGCGTCGCCGCGCCGC GGG Intergenic
No off target data available for this crispr