ID: 1148271722

View in Genome Browser
Species Human (GRCh38)
Location 17:46266885-46266907
Sequence GCCCGTGAGCGCGCGCGTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148271722_1148271734 22 Left 1148271722 17:46266885-46266907 CCGAGACGCGCGCGCTCACGGGC No data
Right 1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG No data
1148271722_1148271732 21 Left 1148271722 17:46266885-46266907 CCGAGACGCGCGCGCTCACGGGC No data
Right 1148271732 17:46266929-46266951 GCCGCGCGCGCGCGCCGCCGAGG No data
1148271722_1148271724 -1 Left 1148271722 17:46266885-46266907 CCGAGACGCGCGCGCTCACGGGC No data
Right 1148271724 17:46266907-46266929 CCCTACGCTTCCCCGCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148271722 Original CRISPR GCCCGTGAGCGCGCGCGTCT CGG (reversed) Intergenic
No off target data available for this crispr