ID: 1148271726

View in Genome Browser
Species Human (GRCh38)
Location 17:46266917-46266939
Sequence GCGCGCGCGGCCGGGCGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148271726_1148271734 -10 Left 1148271726 17:46266917-46266939 CCCCGCCGCCCGGCCGCGCGCGC No data
Right 1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG No data
1148271726_1148271735 -1 Left 1148271726 17:46266917-46266939 CCCCGCCGCCCGGCCGCGCGCGC No data
Right 1148271735 17:46266939-46266961 CGCGCCGCCGAGGGCCCCGCCGG No data
1148271726_1148271742 18 Left 1148271726 17:46266917-46266939 CCCCGCCGCCCGGCCGCGCGCGC No data
Right 1148271742 17:46266958-46266980 CCGGCCCTGCCCACCCCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148271726 Original CRISPR GCGCGCGCGGCCGGGCGGCG GGG (reversed) Intergenic
No off target data available for this crispr