ID: 1148271734

View in Genome Browser
Species Human (GRCh38)
Location 17:46266930-46266952
Sequence CCGCGCGCGCGCGCCGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148271722_1148271734 22 Left 1148271722 17:46266885-46266907 CCGAGACGCGCGCGCTCACGGGC No data
Right 1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG No data
1148271718_1148271734 24 Left 1148271718 17:46266883-46266905 CCCCGAGACGCGCGCGCTCACGG No data
Right 1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG No data
1148271720_1148271734 23 Left 1148271720 17:46266884-46266906 CCCGAGACGCGCGCGCTCACGGG No data
Right 1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG No data
1148271725_1148271734 -1 Left 1148271725 17:46266908-46266930 CCTACGCTTCCCCGCCGCCCGGC No data
Right 1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG No data
1148271723_1148271734 0 Left 1148271723 17:46266907-46266929 CCCTACGCTTCCCCGCCGCCCGG No data
Right 1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG No data
1148271726_1148271734 -10 Left 1148271726 17:46266917-46266939 CCCCGCCGCCCGGCCGCGCGCGC No data
Right 1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148271734 Original CRISPR CCGCGCGCGCGCGCCGCCGA GGG Intergenic
No off target data available for this crispr